Login to display prices
Login to display prices
ZNF273-zinc finger protein 273 Gene View larger

ZNF273-zinc finger protein 273 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF273-zinc finger protein 273 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF273-zinc finger protein 273 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008386
Product type: DNA & cDNA
Ncbi symbol: ZNF273
Origin species: Human
Product name: ZNF273-zinc finger protein 273 Gene
Size: 2ug
Accessions: BC008386
Gene id: 10793
Gene description: zinc finger protein 273
Synonyms: HZF9; zinc finger protein 273; zinc finger protein 9; zinc finger protein HZF9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaccactgacatttagggatgtggccataaaattctctctggaggagtggcaatgcctggacacttcacagcagaatttgtataggaatgtgatgttagataactacagaaacctggtcttcctgggtattgctgtctctaagccagacctgatcacttgtctggagcaaggaaaagagccctgcaatatgaagagacatgcgatggtagccaaacccccaggttggagtgcagtggcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - microseminoprotein, beta-
- kinesin family member 19
- stearoyl-CoA desaturase 5
- zinc finger protein 738