Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HES2-hairy and enhancer of split 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HES2-hairy and enhancer of split 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012091 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HES2 |
| Origin species: | Human |
| Product name: | HES2-hairy and enhancer of split 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC012091 |
| Gene id: | 54626 |
| Gene description: | hairy and enhancer of split 2 (Drosophila) |
| Synonyms: | bHLHb40; transcription factor HES-2; class B basic helix-loop-helix protein 40; hairy and enhancer of split 2; hes family bHLH transcription factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggctgcctcgccgggcaggggacgcggcggagctgcgcaagagcctgaagccgctgctggagaagcgccggcgcgcgcgcatcaaccagagcctgagccagcttaaggggctcatcctgccgctgctgggccgggaggatgcttctggctggcacacctggcttcccctccatgctcagaactgcttcctactctacatccaggctcctgagcagcccccagcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELKS/RAB6-interacting/CAST family member 1 - cellular retinoic acid binding protein 1 - chorionic gonadotropin, beta polypeptide 5 - peptidylprolyl isomerase A (cyclophilin A) |