RPS29-ribosomal protein S29 Gene View larger

RPS29-ribosomal protein S29 Gene

PTXBC032813

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS29-ribosomal protein S29 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS29-ribosomal protein S29 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032813
Product type: DNA & cDNA
Ncbi symbol: RPS29
Origin species: Human
Product name: RPS29-ribosomal protein S29 Gene
Size: 2ug
Accessions: BC032813
Gene id: 6235
Gene description: ribosomal protein S29
Synonyms: DBA13; S29; 40S ribosomal protein S29; ribosomal protein S29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcaccagcagctgtactggagccacccgcgaaaattcggccagggttctcgctcttgtcgtgtctgttcaaaccggcacggtctgatccggaaatatggcctcaatatgtgccgccagtgtttccgtcagtacgcgaaggatatcggtttcattaagttggactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PHD finger protein 5A
- ribosomal protein L35
- pantothenate kinase 2
- MYC associated factor X

Buy RPS29-ribosomal protein S29 Gene now

Add to cart