PHF5A-PHD finger protein 5A Gene View larger

PHF5A-PHD finger protein 5A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHF5A-PHD finger protein 5A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHF5A-PHD finger protein 5A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007321
Product type: DNA & cDNA
Ncbi symbol: PHF5A
Origin species: Human
Product name: PHF5A-PHD finger protein 5A Gene
Size: 2ug
Accessions: BC007321
Gene id: 84844
Gene description: PHD finger protein 5A
Synonyms: INI; Rds3; SAP14b; SF3B7; SF3b14b; bK223H9.2; PHD finger-like domain-containing protein 5A; PHD finger-like domain protein 5A; PHD-finger 5a; splicing factor 3B associated 14 kDa protein; splicing factor 3b, subunit 7; PHD finger protein 5A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctaaacatcatcctgatttgatcttttgccgcaagcaggctggtgttgccatcggaagactgtgtgaaaaatgtgatggcaagtgtgtgatttgtgactcctatgtgcgtccctgcactctggtgcgcatatgtgatgagtgtaactatggatcttaccaggggcgctgtgtgatctgtggaggacctggggtctctgatgcctattattgtaaggagtgcaccatccaggagaaggacagagatggctgcccaaagattgtcaatctggggagctctaagacagacctcttctatgaacgcaaaaaatacggcttcaagaagaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L35
- pantothenate kinase 2
- MYC associated factor X
- ribosomal protein L27

Buy PHF5A-PHD finger protein 5A Gene now

Add to cart