DKC1-dyskeratosis congenita 1, dyskerin Gene View larger

DKC1-dyskeratosis congenita 1, dyskerin Gene

PTXBC009928

New product

Data sheet of DKC1-dyskeratosis congenita 1, dyskerin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DKC1-dyskeratosis congenita 1, dyskerin Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC009928
Product type: DNA & cDNA
Ncbi symbol: DKC1
Origin species: Human
Product name: DKC1-dyskeratosis congenita 1, dyskerin Gene
Size: 2ug
Accessions: BC009928
Gene id: 1736
Gene description: dyskeratosis congenita 1, dyskerin
Synonyms: snoRNP protein DKC1; CBF5; DKC; DKCX; NAP57; NOLA4; XAP101; H/ACA ribonucleoprotein complex subunit 4; CBF5 homolog; dyskeratosis congenita 1, dyskerin; nopp140-associated protein of 57 kDa; nucleolar protein NAP57; nucleolar protein family A member 4; dyskerin pseudouridine synthase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatgcggaagtaattattttgccaaagaaacataagaagaaaaaggagcggaagtcattgccagaagaagatgtagccgaaatacaacacgctgaagaatttcttatcaaacctgaatccaaagttgctaagttggacacgtctcagtggccccttttgctaaagaattttgataagctgaatgtaaggacaacacactatacacctcttgcatgtggttcaaatcctctgaagagagagattggggactatatcaggacaggtttcattaatcttgacaagccctctaacccctcttcccatgaggtggtagcctggattcgacggatacttcgggtggagaagacagggcacagtggtactctggatcccaaggtgactggttgtttaatcgtgtgcatagaacgagccactcgcttggtgaagtcacaacagagtgcaggcaaagagtatgtggggattgtccggctgcacaatgctattgaaggggggacccagctttctagggccctagaaactctgacaggtgccttattccagcgacccccacttattgctgcagtaaagaggcagctccgagtgaggaccatctacgagagcaaaatgattgaatacgatcctgaaagaagattaggaatcttttgggtgagttgtgaggctggcacctacattcggacattatgtgtgcaccttggtttgttattgggagttggtggtcagatgcaggagcttcggagggttcgttctggagtcatgagtgaaaaggaccacatggtgacaatgcatgatgtgcttgatgctcagtggctgtatgataaccacaaggatgagagttacctgcggcgatttgtttaccctttggaaaagctgttgacatctcataaacggctggttatgaaagacagtgcagtaaatgccatctgctatggggccaagattatgcttccaggtgttcttcgatatgaggacggcattgaggtcaatcaggagattgtggttatcaccaccaaaggagaagcaatctgcatggctattgcattaatgaccacagcggtcatctctacctgcgaccatggtatagtagccaagatcaagagagtgatcatggagagagacacttaccctcggaagtggggtttaggtccaaaggcaagtcagaagaagctgatgatcaagcagggccttctggacaagcatgggaagcccacagacagcacacctgccacctggaagcaggagtatgttgactacagtgagtctgccaaaaaagaggtggttgctgaagtggtaaaagccccgcaggtagttgccgaagcagcaaaaactgcgaagcggaagcgagagagtgagagtgaaagtgacgagactcctccagcagctcctcagttgatcaagaaggaaaagaagaagagtaagaaggacaagaaggccaaagctggtctggagagcggggccgagcctggagatggggacagtgataccaccaagaagaagaagaagaagaagaaagcaaaagaggtagaattggtttctgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intercellular adhesion molecule 1
- Leber congenital amaurosis 5-like
- 6-pyruvoyltetrahydropterin synthase
- regulator of G-protein signaling 3