Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINH1-serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) Gene
PTXBC014623
New product
Data sheet of SERPINH1-serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINH1-serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014623 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINH1 |
| Origin species: | Human |
| Product name: | SERPINH1-serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) Gene |
| Size: | 2ug |
| Accessions: | BC014623 |
| Gene id: | 871 |
| Gene description: | serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) |
| Synonyms: | AsTP3; CBP1; CBP2; HSP47; OI10; PIG14; PPROM; RA-A47; SERPINH2; gp46; serpin H1; 47 kDa heat shock protein; arsenic-transactivated protein 3; cell proliferation-inducing gene 14 protein; collagen binding protein 1; colligin-1; colligin-2; rheumatoid arthritis antigen A-47; rheumatoid arthritis-related antigen RA-A47; serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1); serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2, (collagen-binding protein 2); serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1); serpin family H member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgctccctcctgcttctcagcgccttctgcctcctggaggcggccctggccgccgaggtgaagaaacctgcagccgcagcagctcctggcactgcggagaagttgagccccaaggcggccacgcttgccgagcgcagcgccggcctggccttcagcttgtaccaggccatggccaaggaccaggcagtggagaacatcctggtgtcacccgtggtggtggcctcgtcgctggggctcgtgtcgctgggcggcaaggcgaccacggcgtcgcaggccaaggcagtgctgagcgccgagcagctgcgcgacgaggaggtgcacgccggcctgggcgagctgctgcgctcactcagcaactccacggcgcgcaacgtgacctggaagctgggcagccgactgtacggacccagctcagtgagcttcgctgatgacttcgtgcgcagcagcaagcagcactacaactgcgagcactccaagatcaacttccgcgacaagcgcagcgcgctgcagtccatcaacgagtgggccgcgcagaccaccgacggcaagctgcccgaggtcaccaaggacgtggagcgcacggacggcgccctgttagtcaacgccatgttcttcaagccacactgggatgagaaattccaccacaagatggtggacaaccgtggcttcatggtgactcggtcctataccgtgggtgtcatgatgatgcaccggacaggcctctacaactactacgacgacgagaaggaaaagctgcaaatcgtggagatgcccctggcccacaagctctccagcctcatcatcctcatgccccatcacgtggagcctctcgagcgccttgaaaagctgctaaccaaagagcagctgaagatctggatggggaagatgcagaagaaggctgttgccatctccttgcccaagggtgtggtggaggtgacccatgacctgcagaaacacctggctgggctgggcctgactgaggccattgacaagaacaaggccgacttgtcacgcatgtcaggcaagaaggacctgtacctggccagcgtgttccacgccaccgcctttgagttggacacagatggcaacccctttgaccaggacatctacgggcgcgaggagctgcgcagccccaagctgttctacgccgaccaccccttcatcttcctagtgcgggacacccaaagcggctccctgctattcattgggcgcctggtccggcctaagggtgacaagatgcgagacgagttatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |