CYTH2-cytohesin 2 Gene View larger

CYTH2-cytohesin 2 Gene

PTXBC004361

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYTH2-cytohesin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYTH2-cytohesin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004361
Product type: DNA & cDNA
Ncbi symbol: CYTH2
Origin species: Human
Product name: CYTH2-cytohesin 2 Gene
Size: 2ug
Accessions: BC004361
Gene id: 9266
Gene description: cytohesin 2
Synonyms: ARNO; CTS18; CTS18.1; PSCD2; PSCD2L; SEC7L; Sec7p-L; Sec7p-like; cytohesin-2; ARF exchange factor; ARF nucleotide-binding site opener; CTC-273B12.8; PH, SEC7 and coiled-coil domain-containing protein 2; pleckstrin homology, Sec7 and coiled-coil domains 2; pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2); cytohesin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacggcgtctatgaacccccagacctgactccggaggagcggatggagctggagaacatccggcggcggaagcaggagctgctggtggagattcagcgcctgcgggaggagctcagtgaagccatgagcgaggtggaggggctggaggccaatgagggcagtaagaccttgcaacggaaccggaagatggcaatgggcaggaagaagttcaacatggaccccaagaaggggatccagttcttggtggagaatgaactgctgcagaacacacccgaggagatcgcccgcttcctgtacaagggcgaggggctgaacaagacagccatcggggactacctgggggagagggaagaactgaacctggcagtgctccatgcttttgtggatctgcatgagttcaccgacctcaatctggtgcaggccctcaggcagtttctatggagctttcgcctacccggagaggcccagaaaattgaccggatgatggaggccttcgcccagcgatactgcctgtgcaaccctggggttttccagtccacagacacgtgctatgtgctgtccttcgccgtcatcatgctcaacaccagtctccacaatcccaatgtccgggacaagccgggcctggagcgctttgtggccatgaaccggggcatcaacgagggcggggacctgcctgaggagctgctcaggaacctgtacgacagcatccgaaatgagcccttcaagattcctgaggatgacgggaatgacctgacccacaccttcttcaacccggaccgggagggctggctcctgaagctgggagggggccgggtgaagacgtggaagcggcgctggtttatcctcacagacaactgcctctactactttgagtacaccacggacaaggagccccgaggaatcatccccctggagaatctgagcatccgagaggtggacgacccccggaaaccgaactgctttgaactttacatccccaacaacaaggggcagctcatcaaagcctgcaaaactgaggcggacggccgagtggtggagggaaaccacatggtgtaccggatctcggcccccacgcaggaggagaaggacgagtggatcaagtccatccaggcggctgtgagtgtggaccccttctatgagatgctggcagcgagaaagaagcggatttcagtcaagaagaagcaggagcagccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - drebrin-like
- KIAA1683
- paired box 8
- KIAA0409

Buy CYTH2-cytohesin 2 Gene now

Add to cart