KIAA1683-KIAA1683 Gene View larger

KIAA1683-KIAA1683 Gene

PTXBC034327

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1683-KIAA1683 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1683-KIAA1683 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034327
Product type: DNA & cDNA
Ncbi symbol: KIAA1683
Origin species: Human
Product name: KIAA1683-KIAA1683 Gene
Size: 2ug
Accessions: BC034327
Gene id: 80726
Gene description: KIAA1683
Synonyms: uncharacterized protein KIAA1683
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctccgagcagccgctgggacgccatgggccctaaaaattcctacagatccgtgcatggtaggattgttccagaactgctagaaagttctgtggccagggttaggcccttacagtatgtgcaaagacaaccatcccaggcctcagcccgaagtggtgcaaaccccacccacaggccctctgcagaggtaaggcccgtcatccgcactggggagatgacacactcctcggtcattcctccgctggccccgggagttcggagggtgtctctaggctatgagtcttccccaagtggttccctgccacccctttttaaccaggagtcaccgtggagacggcaggactcctatagcccccagaatcctgccgttagtcacaaggcatccctgaactccactatactccagggccccgcggacgctggtgtggttggtggccaatcgtggaaccgcgcatgggagccagccaggggtgctgcgtcctgggacacctggcgcaacaaggcggtggtgcctcccaggcggtccggggagccaatggtgtccatgcaggctgcagaggagatccgcatcctcgcagtgatcactatccaggcgggcgtccgtggctacctggcgcgtcgcaggatccggctgtggcaccggggggccatggtcatccaagctacttggcgcggctaccgtgtgcggcggaacctggcacacctctgcagagccaccacgaccatccagtctgcctggcgcggctacagcacccgccgggaccaagcccggcactggcagatgctccaccccgtcacgtgggtggagctgggcagccgggccggggtcatgtctgaccgaagctggttccaggatggcagagccaggacagtatctgaccatcgctgcttccagtcctgccaggcacacgcttgcagcgtctgccactccctgagctccaggatcgggagcccgcccagcgtggtgatgctagtgggctccagccctcgcacctgtcatacctgtggacgcacacagcccacccgtgtggtgcagggcatgggccagggcactgagggccccggggcagtgtcttgggcctccgcctaccagctggctgccctgagtcccaggcagccgcatcgccaggacaaagcggccacagccatccagtccgcctggaggggctttaagatccgccagcagatgaggcagcagcaaatggcagcgaagatagttcaagccacctggcgaggccaccatacccggagctgtctgaagaacacagaggcgctcttgggaccagcagacccctcggccagctcacggcacatgcattggcctggcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - paired box 8
- KIAA0409
- KIAA1279
- transketolase

Buy KIAA1683-KIAA1683 Gene now

Add to cart