PDLIM3-PDZ and LIM domain 3 Gene View larger

PDLIM3-PDZ and LIM domain 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDLIM3-PDZ and LIM domain 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDLIM3-PDZ and LIM domain 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027870
Product type: DNA & cDNA
Ncbi symbol: PDLIM3
Origin species: Human
Product name: PDLIM3-PDZ and LIM domain 3 Gene
Size: 2ug
Accessions: BC027870
Gene id: 27295
Gene description: PDZ and LIM domain 3
Synonyms: ALP; PDZ and LIM domain protein 3; alpha-actinin-2-associated LIM protein; enigma homolog; PDZ and LIM domain 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccagacggtgatcctcccgggccctgcgccctggggcttcaggctctcagggggcatagacttcaaccagcctttggtcatcaccaggattacaccaggaagcaaggcggcagctgccaacctgtgtcctggagatgtcatcctggctattgacggctttgggacagagtccatgactcatgctgatgcgcaggacaggattaaagcagcagctcaccagctgtgtctcaaaattgacaggggagaaactcacttatggtctccacaagtatctgaagatgggaaagcccatcctttcaaaatcaacttagaatcagaaccacaggaattcaaacccattggtaccgcgcacaacagaagggcccagccttttgttgcagctgcaaacattgatgacaaaagacaggtagtgagcgcttcctataactcgccaattgggctctattcaactagcaatatacaagatgcgcttcacggacagctgcggggtctcattcctagctcacctcaaaacgagcccacagcctcggtgccccccgagtcggacgtgtaccggatgctccacgacaatcggaatgagcccacacagcctcgccagtcgggctccttcagagtgctccagggaatggtggacgatggctctgatgaccgtccggctggaacgcggagtgtgagagctccggtgacgaaagtccatggcggttcaggcggggcacagaggatgccgctctgtgacaaatgtgggagtggcatagttggtgctgtggtgaaggcgcgggataagtaccggcaccctgagtgcttcgtgtgtgccgactgcaacctcaacctcaagcaaaagggctactttttcatagaaggggagctgtactgcgaaacccacgcaagagcccgcacaaagcccccagagggctatgacacggtcactctgtatcccaaagcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription factor 4
- deoxyhypusine synthase
- PHD finger protein 23
- histone deacetylase 3

Buy PDLIM3-PDZ and LIM domain 3 Gene now

Add to cart