Login to display prices
Login to display prices
PDLIM3-PDZ and LIM domain 3 Gene View larger

PDLIM3-PDZ and LIM domain 3 Gene

PTXBC027870

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDLIM3-PDZ and LIM domain 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDLIM3-PDZ and LIM domain 3 Gene

Proteogenix catalog: PTXBC027870
Ncbi symbol: PDLIM3
Product name: PDLIM3-PDZ and LIM domain 3 Gene
Size: 2ug
Accessions: BC027870
Gene id: 27295
Gene description: PDZ and LIM domain 3
Synonyms: ALP; PDZ and LIM domain protein 3; alpha-actinin-2-associated LIM protein; enigma homolog; PDZ and LIM domain 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccagacggtgatcctcccgggccctgcgccctggggcttcaggctctcagggggcatagacttcaaccagcctttggtcatcaccaggattacaccaggaagcaaggcggcagctgccaacctgtgtcctggagatgtcatcctggctattgacggctttgggacagagtccatgactcatgctgatgcgcaggacaggattaaagcagcagctcaccagctgtgtctcaaaattgacaggggagaaactcacttatggtctccacaagtatctgaagatgggaaagcccatcctttcaaaatcaacttagaatcagaaccacaggaattcaaacccattggtaccgcgcacaacagaagggcccagccttttgttgcagctgcaaacattgatgacaaaagacaggtagtgagcgcttcctataactcgccaattgggctctattcaactagcaatatacaagatgcgcttcacggacagctgcggggtctcattcctagctcacctcaaaacgagcccacagcctcggtgccccccgagtcggacgtgtaccggatgctccacgacaatcggaatgagcccacacagcctcgccagtcgggctccttcagagtgctccagggaatggtggacgatggctctgatgaccgtccggctggaacgcggagtgtgagagctccggtgacgaaagtccatggcggttcaggcggggcacagaggatgccgctctgtgacaaatgtgggagtggcatagttggtgctgtggtgaaggcgcgggataagtaccggcaccctgagtgcttcgtgtgtgccgactgcaacctcaacctcaagcaaaagggctactttttcatagaaggggagctgtactgcgaaacccacgcaagagcccgcacaaagcccccagagggctatgacacggtcactctgtatcccaaagcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: