TCF4-transcription factor 4 Gene View larger

TCF4-transcription factor 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCF4-transcription factor 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TCF4-transcription factor 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031056
Product type: DNA & cDNA
Ncbi symbol: TCF4
Origin species: Human
Product name: TCF4-transcription factor 4 Gene
Size: 2ug
Accessions: BC031056
Gene id: 6925
Gene description: transcription factor 4
Synonyms: E2-2; FECD3; ITF-2; ITF2; PTHS; SEF-2; SEF2; SEF2-1; SEF2-1A; SEF2-1B; SEF2-1D; TCF-4; bHLHb19; transcription factor 4; SL3-3 enhancer factor 2; class B basic helix-loop-helix protein 19; immunoglobulin transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcaccaacagcgaatggctgccttagggacggacaaagagctgagtgatttactggatttcagtgcgatgttttcacctcctgtgagcagtgggaaaaatggaccaacttctttggcaagtggacattttactggctcaaatgtagaagacagaagtagctcagggtcctgggggaatggaggacatccaagcccgtccaggaactatggagatgggactccctatgaccacatgaccagcagggaccttgggtcacatgacaatctctctccaccttttgtcaattccagaatacaaagtaaaacagaaaggggctcatactcatcttatgggagagaatcaaacttacagggttgccaccagcagagtctccttggaggtgacatggatatgggcaacccaggaaccctttcgcccaccaaacctggttcccagtactatcagtattctagcaataatccccgaaggaggcctcttcacagtagtgccatggaggtacagacaaagaaagttcgaaaagttcctccaggtttgccatcttcagtctatgctccatcagcaagcactgccgactacaatagggactcgccaggctatccttcctccaaaccagcaaccagcactttccctagctccttcttcatgcaagatggccatcacagcagtgacccttggagctcctccagtgggatgaatcagcctggctatgcaggaatgttgggcaactcttctcatattccacagtccagcagctactgtagcctgcatccacatgaacgtttgagctatccatcacactcctcagcagacatcaattccagtcttcctccgatgtccactttccatcgtagtggtacaaaccattacagcacctcttcctgtacgcctcctgccaacgggacagacagtataatggcaaatagaggaagcggggcagccggcagctcccagactggagatgctctggggaaagcacttgcttcgatctattctccagatcacactaacaacagcttttcatcaaacccttcaactcctgttggctctcctccatctctctcagcaggcacagctgtttggtctagaaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - deoxyhypusine synthase
- PHD finger protein 23
- histone deacetylase 3
- histone deacetylase 1

Buy TCF4-transcription factor 4 Gene now

Add to cart