CD99L2-CD99 molecule-like 2 Gene View larger

CD99L2-CD99 molecule-like 2 Gene

PTXBC030536

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD99L2-CD99 molecule-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD99L2-CD99 molecule-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030536
Product type: DNA & cDNA
Ncbi symbol: CD99L2
Origin species: Human
Product name: CD99L2-CD99 molecule-like 2 Gene
Size: 2ug
Accessions: BC030536
Gene id: 83692
Gene description: CD99 molecule-like 2
Synonyms: CD99B; MIC2L1; CD99 antigen-like protein 2; MIC2 like 1; MIC2-like protein 1; CD99 molecule like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggcctggcgctcggcgttccttgtctgcctcgctttctccttggccaccctggtccagcgaggatctggggactttgatgattttaacctggaggatgcagtgaaagaaacttcctcagtaaagcagccatgggaccacaccaccaccaccacaaccaataggccaggaaccaccagagctccggcaaaacctccaggtagtggattggacttggctgatgctttggatgatcaagatgatggccgcaggaaaccgggtataggaggaagagagagatggaaccatgtaaccaccacgaccaagaggccagtaaccaccagagctccagcaaatactttaggaaatgattttgacttggctgatgccctggatgatcgaaatgatcgagatgatggccgcaggaaaccaattgctggaggaggaggtttttcagacaaggatcttgaagacatagtagggggtggagaatacaaacctgacaagggtaaaggtgatggccggtacggcagcaatgacgaccctggatctggcatggtggcagagcctggcaccattgccggggtggccagcgccctggccatggccctcatcggtgccgtctccagctacatctcctaccagcagaagaagttctgcttcagcattcagcagggtctcaacgcagactacgtgaagggagagaacctggaagccgtggtatgtgaggaaccccaagtgaaatactccacgttgcacacgcagtctgcagagccgccgccgccgcccgaaccagcccggatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - germ cell associated 1
- distal-less homeobox 3
- SLAM family member 7
- PDZ and LIM domain 3

Buy CD99L2-CD99 molecule-like 2 Gene now

Add to cart