Login to display prices
Login to display prices
RPL19-ribosomal protein L19 Gene View larger

RPL19-ribosomal protein L19 Gene

PTXBC000530

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL19-ribosomal protein L19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL19-ribosomal protein L19 Gene

Proteogenix catalog: PTXBC000530
Ncbi symbol: RPL19
Product name: RPL19-ribosomal protein L19 Gene
Size: 2ug
Accessions: BC000530
Gene id: 6143
Gene description: ribosomal protein L19
Synonyms: L19; 60S ribosomal protein L19; ribosomal protein L19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtatgctcaggcttcagaagaggctcgcctctagtgtcctccgctgtggcaagaagaaggtctggttagaccccaatgagaccaatgaaatcgccaatgccaactcccgtcagcagatccggaagctcatcaaagatgggctgatcatccgcaagcctgtgacggtccattcccgggctcgatgccggaaaaacaccttggcccgccggaagggcaggcacatgggcataggtaagcggaagggtacagccaatgcccgaatgccagagaaggtcacatggatgaggagaatgaggattttgcgccggctgctcagaagataccgtgaatctaagaagatcgatcgccacatgtatcacagcctgtacctgaaggtgaaggggaatgtgttcaaaaacaagcggattctcatggaacacatccacaagctgaaggcagacaaggcccgcaagaagctcctggctgaccaggctgaggcccgcaggtctaagaccaaggaagcacgcaagcgccgtgaagagcgcctccaggccaagaaggaggagatcatcaagactttatccaaggaggaagagaccaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: