Login to display prices
Login to display prices
EXOC8-exocyst complex component 8 Gene View larger

EXOC8-exocyst complex component 8 Gene


New product

Data sheet of EXOC8-exocyst complex component 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EXOC8-exocyst complex component 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035763
Product type: DNA & cDNA
Ncbi symbol: EXOC8
Origin species: Human
Product name: EXOC8-exocyst complex component 8 Gene
Size: 2ug
Accessions: BC035763
Gene id: 149371
Gene description: exocyst complex component 8
Synonyms: EXO84; Exo84p; SEC84; exocyst complex component 8; exocyst complex 84 kDa subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggacagtggggcgagccgcctgcgtcggcagctggagtcagggggttttgaggcgcggctgtacgtgaagcagctctcgcagcagtcggatggggaccgggacctccaggagcaccggcagcgcatccaggcgctggcggaggagacggcgcagaacctgaagcgcaacgtctaccagaactaccggcagttcatagagacggcccgcgagatctcctacctggagagcgagatgtaccagctcagccatttgctgaccgagcagaaaagcagcctggagagcatcccgcttacgttgctgcctgccgctgctgccgccggagccgccgccgcctctggaggggaggagggagtcggtggggcggggggccgagaccacctccgaggccaggccggctttttctccacccccgggggtgcctcccgcgacggctccggtccaggcgaggaaggaaagcagcgcactctcaccaccctgcttgagaaggtggaaggctgcaggcatctgctggagacgccgggacagtacttggtgtacaatggggacctagtggaatacgatgcggaccacatggcccaactgcagcgggtgcacggctttctcatgaacgattgcttgttggtggctacctggctgcctcagcggcgtgggatgtatcgctacaacgctctctattccctagatggtttggccgtagtcaatgtcaaggacaacccgcccatgaaggacatgttcaagctgcttatgttccccgagagccgtattttccaggccgaaaatgctaaaatcaaacgagagtggctggaagtgctggaggacaccaagagggccctcagtgagaaaaggcgaagggagcaggaggaggcagcggcccctcgagggccaccccaagtgacttccaaggccactaacccatttgaggatgacgaagaagaagaaccagctgttcctgaggtagaggaagagaaggtggacctctccatggaatggatccaggagttacctgaagacctggatgtctgcattgcgcagagagactttgaaggggcggttgacctgctggataaattgaaccattacctggaagataaacctagcccacctcctgtaaaagaactaagggccaaagtggaggagcgagttcgacagctcactgaggtgctagttttcgaactctccccagatcgttccctgagaggtggtccgaaggctactcgcagagcagtttcgcaactgatccggctgggccagtgcacgaaggcctgtgagctatttttgagaaacagggcagccgctgttcatactgcaattcgtcagcttcgcatcgaaggtgccactttactctatattcataagctgtgccatgtcttctttaccagccttctcgagactgcaagagaatttgagatcgattttgcaggcactgacagcggctgctactctgcctttgtggtctgggcaagatcagccatgggcatgttcgtggatgcttttagcaagcaggtgtttgatagtaaggagagcctctctacagcagctgagtgtgtaaaagtggctaaggagcattgccagcaactgggtgatatcggactggatctcaccttcatcatccatgcccttctggtgaaagacatccaaggggccttgcacagttacaaagaaatcatcattgaagccactaaacatcgcaactctgaagagatgtggaggaggatgaacttgatgacgccagaagccctgggtaagctcaaagaagagatgaaaagttgtggggtaagtaactttgagcagtacacaggggatgactgctgggtgaacctaagttacacagtggttgctttcaccaaacagaccatgggcttcttggaagaggccctgaagctgtatttcccagagctgcacatggtacttttggagagcctggtggaaatcattttggttgctgttcagcatgtggattatagtcttcgatgtgagcaggatccagagaagaaagcttttatcagacagaatgcatcctttttatatgaaacagtcctccctgtggtggagaaaaggtttgaagaaggtgtggggaaacctgccaagcaactccaagatctgaggaatgcatctagacttattcgtgtgaatcctgaaagtacaacatcagtggtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 63A
- exostoses (multiple)-like 3
- retinoblastoma-like 1 (p107)
- transmembrane protein 14C