Login to display prices
Login to display prices
CEP70-centrosomal protein 70kDa Gene View larger

CEP70-centrosomal protein 70kDa Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CEP70-centrosomal protein 70kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CEP70-centrosomal protein 70kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016050
Product type: DNA & cDNA
Ncbi symbol: CEP70
Origin species: Human
Product name: CEP70-centrosomal protein 70kDa Gene
Size: 2ug
Accessions: BC016050
Gene id: 80321
Gene description: centrosomal protein 70kDa
Synonyms: BITE; centrosomal protein of 70 kDa; centrosomal protein 70kDa; p10-binding protein; testicular tissue protein Li 36; centrosomal protein 70
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttccggtagcccctaaaccccaggattccagtcaaccatcagacagactcatgactgaaaaacagcaggaagaagcagaatgggaaagcataaatgtgctattgatgatgcatggcttaaaacctttgtctctagtcaaaagaacagatctcaaagatctcatcatttttgacaaacagtcatcacaaaggatgagacagaatttgaaattgttggtggaagaaacatcatgtcaacagaacatgatacaggagcttatagaaactaatcaacagcttagaaatgaacttcagctagagcaaagccgagcagccaatcaagaacaacgagctaatgacttggaacaaattatggaaagtgtgaaatccaaaattggtgaattggaggatgaatcactaaatagggcttgccaccaacagaataaaataaaagatcttcaaaaggagcagaaaactttacaggtgaagtgccagcattataagaaaaaacgaacggagcaagaagaaactattgcttctttgcaaatggaagtctgtagattaaaaaaggaggaagaagatcgcattgtcactcaaaacagagtgtttgcctatctgtgcaaaagagttcctcataccgtcttggatagacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 27
- immediate early response 2
- adenylate kinase 3-like 1
- transmembrane protein 43