Cart 9 Product Products 1 061,10 € (empty)
-
1 x CCDC114-co...121,50 € -
1 x DKK1-dickk...121,50 € -
1 x FOXP2-fork...113,40 € -
1 x PSMB10-pro...121,50 € -
1 x PPIAL4G-pe...113,40 € -
1 x PPAP2B-pho...121,50 € -
1 x PRPF40A-PR...113,40 € -
1 x C6orf134-c...121,50 € -
1 x PSME3-prot...113,40 €
No products
To be determined Shipping
1 061,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 061,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 061,10 €
Data sheet of CEP70-centrosomal protein 70kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CEP70-centrosomal protein 70kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016050 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CEP70 |
| Origin species: | Human |
| Product name: | CEP70-centrosomal protein 70kDa Gene |
| Size: | 2ug |
| Accessions: | BC016050 |
| Gene id: | 80321 |
| Gene description: | centrosomal protein 70kDa |
| Synonyms: | BITE; centrosomal protein of 70 kDa; centrosomal protein 70kDa; p10-binding protein; testicular tissue protein Li 36; centrosomal protein 70 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttccggtagcccctaaaccccaggattccagtcaaccatcagacagactcatgactgaaaaacagcaggaagaagcagaatgggaaagcataaatgtgctattgatgatgcatggcttaaaacctttgtctctagtcaaaagaacagatctcaaagatctcatcatttttgacaaacagtcatcacaaaggatgagacagaatttgaaattgttggtggaagaaacatcatgtcaacagaacatgatacaggagcttatagaaactaatcaacagcttagaaatgaacttcagctagagcaaagccgagcagccaatcaagaacaacgagctaatgacttggaacaaattatggaaagtgtgaaatccaaaattggtgaattggaggatgaatcactaaatagggcttgccaccaacagaataaaataaaagatcttcaaaaggagcagaaaactttacaggtgaagtgccagcattataagaaaaaacgaacggagcaagaagaaactattgcttctttgcaaatggaagtctgtagattaaaaaaggaggaagaagatcgcattgtcactcaaaacagagtgtttgcctatctgtgcaaaagagttcctcataccgtcttggatagacagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 27 - immediate early response 2 - adenylate kinase 3-like 1 - transmembrane protein 43 |