Login to display prices
Login to display prices
MXD3-MAX dimerization protein 3 Gene View larger

MXD3-MAX dimerization protein 3 Gene

PTXBC000745

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MXD3-MAX dimerization protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MXD3-MAX dimerization protein 3 Gene

Proteogenix catalog: PTXBC000745
Ncbi symbol: MXD3
Product name: MXD3-MAX dimerization protein 3 Gene
Size: 2ug
Accessions: BC000745
Gene id: 83463
Gene description: MAX dimerization protein 3
Synonyms: BHLHC13; MAD3; MYX; max dimerization protein 3; Max-associated protein 3; Max-interacting transcriptional repressor MAD3; class C basic helix-loop-helix protein 13; max dimerizer 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacccttggccagcaacatccaggtcctgctgcaggcggccgagttcctggagcgccgtgagagagaggccgagcatggttatgcgtccctgtgcccgcatcgcagtccaggccccatccacaggaggaagaagcgacccccccaggctcctggcgcgcaggacagcgggcggtcagtgcacaatgaactggagaagcgcaggagggcccagttgaagcggtgcctggagcggctgaagcagcagatgcccctgggggccgactgtgcccggtacaccacgctgagcctgctgcgccgtgccaggatgcacatccagaagctggaggatcaggagcagcgggcccgacagctcaaggagaggctgcgcagcaagcagcagagcctgcagcggcagctggagcagctccgggggctggcaggggcggccgagcgggagcggctgcgggcggacagtctggactcctcaggcctctcctctgagcgctcagactcagaccaagaggagctggaggtggatgtggagagcctggtgtttgggggtgaggccgagctgctgcggggcttcgtcgccggccaggagcacagctactcgcacggcggcggcgcctggctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: