Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MXD3-MAX dimerization protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MXD3-MAX dimerization protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000745 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MXD3 |
| Origin species: | Human |
| Product name: | MXD3-MAX dimerization protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC000745 |
| Gene id: | 83463 |
| Gene description: | MAX dimerization protein 3 |
| Synonyms: | BHLHC13; MAD3; MYX; max dimerization protein 3; Max-associated protein 3; Max-interacting transcriptional repressor MAD3; class C basic helix-loop-helix protein 13; max dimerizer 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacccttggccagcaacatccaggtcctgctgcaggcggccgagttcctggagcgccgtgagagagaggccgagcatggttatgcgtccctgtgcccgcatcgcagtccaggccccatccacaggaggaagaagcgacccccccaggctcctggcgcgcaggacagcgggcggtcagtgcacaatgaactggagaagcgcaggagggcccagttgaagcggtgcctggagcggctgaagcagcagatgcccctgggggccgactgtgcccggtacaccacgctgagcctgctgcgccgtgccaggatgcacatccagaagctggaggatcaggagcagcgggcccgacagctcaaggagaggctgcgcagcaagcagcagagcctgcagcggcagctggagcagctccgggggctggcaggggcggccgagcgggagcggctgcgggcggacagtctggactcctcaggcctctcctctgagcgctcagactcagaccaagaggagctggaggtggatgtggagagcctggtgtttgggggtgaggccgagctgctgcggggcttcgtcgccggccaggagcacagctactcgcacggcggcggcgcctggctatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrosomal protein 70kDa - transmembrane protein 27 - immediate early response 2 - adenylate kinase 3-like 1 |