PDPN-podoplanin Gene View larger

PDPN-podoplanin Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDPN-podoplanin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDPN-podoplanin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014668
Product type: DNA & cDNA
Ncbi symbol: PDPN
Origin species: Human
Product name: PDPN-podoplanin Gene
Size: 2ug
Accessions: BC014668
Gene id: 10630
Gene description: podoplanin
Synonyms: AGGRUS; GP36; GP40; Gp38; HT1A-1; OTS8; PA2.26; T1A; T1A-2; T1A2; TI1A; PA2.26 antigen; T1-alpha; glycoprotein 36; glycoprotein, 36-KD; hT1alpha-1; hT1alpha-2; lung type I cell membrane associated glycoprotein; lung type-I cell membrane-associated glycoprotein (T1A-2)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaaggtgtcagctctgctcttcgttttgggaagcgcgtcgctctgggtcctggcagaaggagccagcacaggccagccagaagatgacactgagactacaggtttggaaggcggcgttgccatgccaggtgccgaagatgatgtggtgactccaggaaccagcgaagaccgctataagtctggcttgacaactctggtggcaacaagtgtcaacagtgtaacaggcattcgcatcgaggatctgccaacttcagaaagcacagtccacgcgcaagaacaaagtccaagcgccacagcctcaaacgtggccaccagtcactccacggagaaagtggatggagacacacagacaacagttgagaaagatggtttgtcaacagtgaccctggttggaatcatagttggggtcttactagccatcggcttcattggtggaatcatcgttgtggttatgcgaaaaatgtcgggaaggtactcgccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin 3
- ubiquitin B
- surfeit 2
- cullin 4B

Buy PDPN-podoplanin Gene now

Add to cart