Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PDPN-podoplanin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDPN-podoplanin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDPN |
| Origin species: | Human |
| Product name: | PDPN-podoplanin Gene |
| Size: | 2ug |
| Accessions: | BC014668 |
| Gene id: | 10630 |
| Gene description: | podoplanin |
| Synonyms: | AGGRUS; GP36; GP40; Gp38; HT1A-1; OTS8; PA2.26; T1A; T1A-2; T1A2; TI1A; PA2.26 antigen; T1-alpha; glycoprotein 36; glycoprotein, 36-KD; hT1alpha-1; hT1alpha-2; lung type I cell membrane associated glycoprotein; lung type-I cell membrane-associated glycoprotein (T1A-2) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggaaggtgtcagctctgctcttcgttttgggaagcgcgtcgctctgggtcctggcagaaggagccagcacaggccagccagaagatgacactgagactacaggtttggaaggcggcgttgccatgccaggtgccgaagatgatgtggtgactccaggaaccagcgaagaccgctataagtctggcttgacaactctggtggcaacaagtgtcaacagtgtaacaggcattcgcatcgaggatctgccaacttcagaaagcacagtccacgcgcaagaacaaagtccaagcgccacagcctcaaacgtggccaccagtcactccacggagaaagtggatggagacacacagacaacagttgagaaagatggtttgtcaacagtgaccctggttggaatcatagttggggtcttactagccatcggcttcattggtggaatcatcgttgtggttatgcgaaaaatgtcgggaaggtactcgccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - claudin 3 - ubiquitin B - surfeit 2 - cullin 4B |