Login to display prices
Login to display prices
SEPX1-selenoprotein X, 1 Gene View larger

SEPX1-selenoprotein X, 1 Gene

PTXBC003127

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEPX1-selenoprotein X, 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SEPX1-selenoprotein X, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003127
Product type: DNA & cDNA
Ncbi symbol: SEPX1
Origin species: Human
Product name: SEPX1-selenoprotein X, 1 Gene
Size: 2ug
Accessions: BC003127
Gene id: 51734
Gene description: selenoprotein X, 1
Synonyms: SEPX1; HSPC270; SELR; SELX; SepR; methionine-R-sulfoxide reductase B1; selenoprotein R; selenoprotein X, 1; methionine sulfoxide reductase B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgttctgcagcttcttcgggggcgaggttttccagaatcactttgaacctggcgtttacgtgtgtgccaagtgtggctatgagctgttctccagccgctcgaagtatgcacactcgtctccatggccggcgttcaccgagaccattcacgccgacagcgtggccaagcgtccggagcacaatagatctgaagccttgaaggtgtcctgtggcaagtgtggcaatgggttgggccacgagttcctgaacgacggccccaagccggggcagtcccgattctgaatattcagcagctcgctgaagtttgtccctaaaggcaaagaaacttctgcctcccagggtcactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calmodulin-like 4
- FOS-like antigen 2
- hemoglobin, gamma A
- hemoglobin, gamma A