NNAT-neuronatin Gene View larger

NNAT-neuronatin Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NNAT-neuronatin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NNAT-neuronatin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001768
Product type: DNA & cDNA
Ncbi symbol: NNAT
Origin species: Human
Product name: NNAT-neuronatin Gene
Size: 2ug
Accessions: BC001768
Gene id: 4826
Gene description: neuronatin
Synonyms: Peg5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcagtggcggcggcctcggctgaactgctcatcatcggctggtacatcttccgcgtgctgctgcaggtgttcctggaatgctgcatttactgggtaggattcgcttttcgaaatcctccagggacacagcccattgcgagaagtgaggtgttcaggtactccctgcagaagctggcatacacggtgtcgcggaccgggcggcaggtgttgggggagcgcaggcagcgagcccccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuritin 1
- DC2 protein
- podoplanin
- claudin 3

Buy NNAT-neuronatin Gene now

Add to cart