ACOX1-acyl-Coenzyme A oxidase 1, palmitoyl Gene View larger

ACOX1-acyl-Coenzyme A oxidase 1, palmitoyl Gene


New product

Data sheet of ACOX1-acyl-Coenzyme A oxidase 1, palmitoyl Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACOX1-acyl-Coenzyme A oxidase 1, palmitoyl Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010425
Product type: DNA & cDNA
Ncbi symbol: ACOX1
Origin species: Human
Product name: ACOX1-acyl-Coenzyme A oxidase 1, palmitoyl Gene
Size: 2ug
Accessions: BC010425
Gene id: 51
Gene description: acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms: ACOX; PALMCOX; SCOX; peroxisomal acyl-coenzyme A oxidase 1; AOX; acyl-CoA oxidase 1, palmitoyl; acyl-CoA oxidase, straight-chain; acyl-Coenzyme A oxidase 1, palmitoyl; palmitoyl-CoA oxidase; peroxisomal fatty acyl-CoA oxidase; straight-chain acyl-CoA oxidase; acyl-CoA oxidase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacccggacctgcgcagggagcgggattccgccagcttcaacccggagctgcttacacacatcctggacggcagccccgagaaaacccggcgccgccgagagatcgagaacatgatcctgaacgacccagacttccagcatgaggacttgaacttcctcactcgcagccagcgttatgaggtggctgtcaggaaaagtgccatcatggtgaagaagatgagggagtttggcatcgctgaccctgatgaaattatgtggtttaaaaattttgtgcaccgagggcggcctgagcctctggatcttcacttgggcatgttcctgcccaccttgcttcaccaggcaactgcggagcagcaggagcgcttcttcatgcccgcctggaacttggagatcattggcacttatgcccagacagagatgggtcatggaactcaccttcgaggcttggaaaccatagccacgtatgaccctgaaacccaggagttcattctcaacagtcctactgtgacctccattaaatggtggcctggtgggcttggaaagacttcaaatcatgcaatagttcttgcccagctcatcactaaggggaaatgctatggattacatgcctttatcgtacctattcgtgaaatcgggacccataagcctttgccaggaattaccgttggtgacatcggccccaaatttggttatgatgagatagacaatggctacctcaaaatggacaaccatcgtattcccagagaaaacatgctgatgaagtatgcccaggtgaagcctgatggcacatacgtgaaaccgctgagtaacaagctgacttacgggaccatggtgtttgtcaggtccttccttgtgggagaagctgctcgggctctgtctaaggcgtgcaccattgccatccgatacagcgctgtgaggcaccagtctgaaatgaagccaggtgaaccagaaccacagattttggattttcaaacccagcagtataaactctttccactcctggccactgcctatgccttccagtttgtgggcgcatacatgaaggagacctatcaccggattaacgaaggcattggtcaaggggacctgagtgaactgcctgagcttcatgccctcaccgctggactgaaggctttcacctcctggactgcaaacactggcattgaagcatgtcggatggcttgtggtgggcatggctattctcattgcagtggtcttccaaatatttatgtcaatttcaccccaagctgtacctttgagggagaaaacactgtcatgatgctccagacggctaggttcctgatgaaaagttatgatcaggtgcactcaggaaagttggtgtgtggcatggtgtcctatttgaacgacctgcccagtcagcgcatccagccacagcaggtagcagtctggccaaccatggtggatatcaacagccccgaaagcctaaccgaagcatataaactccgtgcagccagattagtagaaattgctgcaaaaaaccttcaaaaagaagtgattcacagaaaaagcaaggaggtagcttggaacctaacttctgttgaccttgttcgagcaagtgaggcacattgccactatgtggtagttaagctcttttcagaaaaactcctcaaaattcaagataaagccattcaagctgtcttaaggagtttatgtctgctgtattctctgtatggaatcagtcagaacgcgggggatttccttcaggggagcatcatgacagagcctcagattacacaagtaaaccagcgtgtaaaggagttactcactctgattcgctcagatgctgttgctttggttgatgcatttgattttcaggatgtgacacttggctctgtgcttggccgctatgatgggaatgtgtatgaaaacttgtttgagtgggctaagaactccccactgaacaaagcagaggtccacgaatcttacaagcacctgaagtcactgcagtccaagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine carboxyl methyltransferase 2
- chromosome 6 open reading frame 48
- chromosome 9 open reading frame 70
- mitochondrial ribosomal protein L33

Buy ACOX1-acyl-Coenzyme A oxidase 1, palmitoyl Gene now

Add to cart