C22orf28-chromosome 22 open reading frame 28 Gene View larger

C22orf28-chromosome 22 open reading frame 28 Gene


New product

Data sheet of C22orf28-chromosome 22 open reading frame 28 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf28-chromosome 22 open reading frame 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010308
Product type: DNA & cDNA
Ncbi symbol: C22orf28
Origin species: Human
Product name: C22orf28-chromosome 22 open reading frame 28 Gene
Size: 2ug
Accessions: BC010308
Gene id: 51493
Gene description: chromosome 22 open reading frame 28
Synonyms: C22orf28; DJ149A16.6; FAAP; HSPC117; tRNA-splicing ligase RtcB homolog; ankyrin repeat domain 54; focal adhesion-associated protein; RNA 2',3'-cyclic phosphate and 5'-OH ligase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcgcagctataatgatgagctgcagttcttggagaagatcaataaaaactgctggaggatcaagaagggcttcgtgcccaacatgcaggttgaaggtgttttctatgtgaatgatgctctggagaaattgatgtttgaggaattaaggaatgcctgtcgaggtggtggtgttggtggcttcctgccagccatgaaacagattggcaatgtggcagccctgcctggaattgttcatcgatctattgggcttcctgatgtccattcaggatatgggtttgctattgggaacatggcagcctttgatatgaatgaccctgaagcagtagtatccccaggtggtgtcgggtttgacatcaactgtggtgtccgcttgctaagaaccaatttagatgaaagtgatgtccagcctgtgaaggagcaacttgcccaagctatgtttgaccacattcctgttggggtggggtcaaaaggtgtcatcccaatgaatgccaaagacttggaggaggccttggagatgggggtggactggtccttaagagaagggtatgcctgggctgaagacaaggagcactgcgaggagtacggaaggatgctgcaagctgaccccaataaagtttctgcaagggcgaagaaaagaggccttcctcagttggggaccctgggagcaggcaaccattatgcagaaatccaggttgtggatgagattttcaatgagtatgctgctaaaaaaatgggcatcgaccataagggacaggtgtgtgtgatgatccacagtggaagcagaggcttgggccaccaagtagccacagatgcgctggtagctatggagaaggccatgaagagagacaagattatagtcaatgatcggcagttggcttgtgctcgaatcgcttccccagagggtcaagactatctgaagggaatggcagctgctgggaactatgcctgggtcaaccgctcttccatgaccttcttaacccgtcaggctttcgccaaggtcttcaacacaacccctgatgacttggacctacatgtgatctatgatgtttctcacaacattgccaaagtggagcagcatgtggtggacggaaaggaacggacactgttagtacacaggaagggatccacccgcgctttccctcctcaccatcccctcattgctgttgattaccaactcactggacagccagtgctcattggtggcaccatgggaacctgtagttatgttcttactggcactgaacagggcatgactgagacctttggaacaacctgtcatggagcgggccgtgcattgtcccgagcaaaatctcgacgtaatttagatttccaggatgtcttagacaaattggcagatatgggaattgcgatccgtgttgcctcacccaaactggttatggaagaggctcctgagtcctataagaatgtgacagatgtggtaaatacctgccatgatgctggaatcagcaagaaagccattaaactgagaccaattgctgtgatcaaaggatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - karyopherin alpha 3 (importin alpha 4)
- polypyrimidine tract binding protein 1
- component of oligomeric golgi complex 4
- chromosome 12 open reading frame 11

Buy C22orf28-chromosome 22 open reading frame 28 Gene now

Add to cart