PTBP1-polypyrimidine tract binding protein 1 Gene View larger

PTBP1-polypyrimidine tract binding protein 1 Gene


New product

Data sheet of PTBP1-polypyrimidine tract binding protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTBP1-polypyrimidine tract binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004383
Product type: DNA & cDNA
Ncbi symbol: PTBP1
Origin species: Human
Product name: PTBP1-polypyrimidine tract binding protein 1 Gene
Size: 2ug
Accessions: BC004383
Gene id: 5725
Gene description: polypyrimidine tract binding protein 1
Synonyms: HNRNP-I; HNRNPI; HNRPI; PTB; PTB-1; PTB-T; PTB2; PTB3; PTB4; pPTB; polypyrimidine tract-binding protein 1; 57 kDa RNA-binding protein PPTB-1; RNA-binding protein; heterogeneous nuclear ribonucleoprotein I; heterogeneous nuclear ribonucleoprotein polypeptide I; hnRNP I; polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I); polypyrimidine tract binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggcattgtcccagatatagccgttggtacaaagcggggatctgacgagcttttctctacttgtgtcactaacggaccgtttatcatgagcagcaactcggcttctgcagcaaacggaaatgacagcaagaagttcaaaggtgacagccgaagtgcaggcgtcccctctagagtgatccacatccggaagctccccatcgacgtcacggagggggaagtcatctccctggggctgccctttgggaaggtcaccaacctcctgatgctgaaggggaaaaaccaggccttcatcgagatgaacacggaggaggctgccaacaccatggtgaactactacacctcggtgacccctgtgctgcgcggccagcccatctacatccagttctccaaccacaaggagctgaagaccgacagctctcccaaccaggcgcgggcccaggcggccctgcaggcggtgaactcggtccagtcggggaacctggccttggctgcctcggcggcggccgtggacgcagggatggcgatggccgggcagagccccgtgctcaggatcatcgtggagaacctcttctaccctgtgaccctggatgtgctgcaccagattttctccaagttcggcacagtgttgaagatcatcaccttcaccaagaacaaccagttccaggccctgctgcagtatgcggaccccgtgagcgcccagcacgccaagctgtcgctggacgggcagaacatctacaacgcctgctgcacgctgcgcatcgacttttccaagctcaccagcctcaacgtcaagtacaacaatgacaagagccgtgactacacacgcccagacctgccttccggggacagccagccctcgctggaccagaccatggccgcggccttcggcctttccgttccgaacgtccacggcgccctggcccccctggccatcccctcggcggcggcggcagctgcggcggcaggtcggatcgccatcccgggcctggcgggggcaggaaattctgtattgctggtcagcaacctcaacccagagagagtcacaccccaaagcctctttattcttttcggcgtctacggtgacgtgcagcgcgtgaagatcctgttcaataagaaggagaacgccctagtgcagatggcggacggcaaccaggcccagctggccatgagccacctgaacgggcacaagctgcacgggaagcccatccgcatcacgctctcgaagcaccagaacgtgcagctgccccgcgagggccaggaggaccagggcctgaccaaggactacggcaactcacccctgcaccgcttcaagaagccgggctccaagaacttccagaacatattcccgccctcggccacgctgcacctctccaacatcccgccctcagtctccgaggaggatctcaaggtcctgttttccagcaatgggggcgtcgtcaaaggattcaagttcttccagaaggaccgcaagatggcactgatccagatgggctccgtggaggaggcggtccaggccctcattgacctgcacaaccacgacctcggggagaaccaccacctgcgggtctccttctccaagtccaccatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - component of oligomeric golgi complex 4
- chromosome 12 open reading frame 11
- glutamate receptor, ionotropic, AMPA 2
- glutamate receptor, ionotropic, AMPA 2

Buy PTBP1-polypyrimidine tract binding protein 1 Gene now

Add to cart