Login to display prices
Login to display prices
HCLS1-hematopoietic cell-specific Lyn substrate 1 Gene View larger

HCLS1-hematopoietic cell-specific Lyn substrate 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HCLS1-hematopoietic cell-specific Lyn substrate 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HCLS1-hematopoietic cell-specific Lyn substrate 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016758
Product type: DNA & cDNA
Ncbi symbol: HCLS1
Origin species: Human
Product name: HCLS1-hematopoietic cell-specific Lyn substrate 1 Gene
Size: 2ug
Accessions: BC016758
Gene id: 3059
Gene description: hematopoietic cell-specific Lyn substrate 1
Synonyms: CTTNL; HS1; lckBP1; p75; hematopoietic lineage cell-specific protein; hematopoietic cell-specific Lyn substrate 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaagtctgtagtgggccatgatgtgtctgtttccgtggagacccagggtgatgattgggacacagatcctgactttgtgaatgacatctctgaaaaggagcaacgatggggagccaagaccatcgaggggtctggacgcacagaacacatcaacatccaccagctgaggaacaaagtatcagaggagcatgatgttctcaggaagaaagagatggagtcagggcccaaagcatcccatggctatggaggtcggtttggagtagaaagagaccgaatggacaagagtgcagtgggccatgagtatgttgccgaggtggagaagcactcttctcagacggatgctgccaaaggctttgggggcaagtacggagttgagagggacagggcagacaagtcagcagtcggctttgattataaaggagaagtggagaagcatacatctcagaaagattactctcgtggctttggtggccggtacggggtggagaaggataaatgggacaaagcagctctgggatatgactacaagggagagacggagaaacacgagtcccagagagattatgccaagggctttggtggccagtatggaatccagaaggaccgagtggataagagcgctgtcggcttcaatgaaatggaggccccgaccacagcttataagaagacgacgcccatagaagccgcttctagtggtgcccgtgggctgaaggcgaaatttgagtccatggctgaggagaagaggaagcgagaggaagaggagaaggcacagcaggtggccaggaggcaacaggagcgaaaggctgtgacaaagaggagccctgaggctccacagccagtgatagctatggaagagccagcagtaccggccccactgcccaagaaaatctcctcagaggcctggcctccagttgggactcctccatcatcagagtctgagcctgtgagaaccagcagggaacacccagtgcccttgctgcccattaggcagactctcccggaggacaatgaggagcccccagctctgccccctaggactctggaaggcctccaggtggaggaagagccagtgtacgaagcagagcctgagcctgagcccgagcctgagcccgagcctgagaatgactatgaggacgttgaggagatggacaggcatgagcaggaggatgaaccagagggggactatgaggaggtgctcgagcctgaagattcttctttttcttctgctctggctggatcatcaggctgcccggctggggctggggctggggctgtggctctggggatctcagctgtggctctatatgattaccaaggagagggaagtgatgagctttcctttgatccggacgacgtaatcactgacattgagatggtggacgagggctggtggcggggacgttgccatggccactttggactcttccctgcaaattatgtcaagcttctggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - caspase recruitment domain family, member 9
- germ cell-less homolog 1 (Drosophila)-like
- ilvB (bacterial acetolactate synthase)-like
- CCR4-NOT transcription complex, subunit 10