ENO1-enolase 1, (alpha) Gene View larger

ENO1-enolase 1, (alpha) Gene

PTXBC001810

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ENO1-enolase 1, (alpha) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ENO1-enolase 1, (alpha) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001810
Product type: DNA & cDNA
Ncbi symbol: ENO1
Origin species: Human
Product name: ENO1-enolase 1, (alpha) Gene
Size: 2ug
Accessions: BC001810
Gene id: 2023
Gene description: enolase 1, (alpha)
Synonyms: ENO1L1; HEL-S-17; MPB1; NNE; PPH; alpha-enolase; c-myc promoter-binding protein-1; 2-phospho-D-glycerate hydro-lyase; MYC promoter-binding protein 1; alpha enolase like 1; enolase 1, (alpha); enolase-alpha; epididymis secretory protein Li 17; non-neural enolase; phosphopyruvate hydratase; plasminogen-binding protein; tau-crystallin; enolase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctattctcaagatccatgccagggagatctttgactctcgcgggaatcccactgttgaggttgatctcttcacctcaaaaggtctcttcagagctgctgtgcccagtggtgcttcaactggtatctatgaggccctagagctccgggacaatgataagactcgctatatggggaagggtgtctcaaaggctgttgagcacatcaataaaactattgcgcctgccctggttagcaagaaactgaacgtcacagaacaagagaagattgacaaactgatgatcgagatggatggaacagaaaataaatctaagtttggtgcgaacgccattctgggggtgtcccttgccgtctgcaaagctggtgccgttgagaagggggtccccctgtaccgccacatcgctgacttggctggcaactctgaagtcatcctgccagtcccggcgttcaatgtcatcaatggcggttctcatgctggcaacaagctggccatgcaggagttcatgatcctcccagtcggtgcagcaaacttcagggaagccatgcgcattggagcagaggtttaccacaacctgaagaatgtcatcaaggagaaatatgggaaagatgccaccaatgtgggggatgaaggcgggtttgctcccaacatcctggagaataaagaaggcctggagctgctgaagactgctattgggaaagctggctacactgataaggtggtcatcggcatggacgtagcggcctccgagttcttcaggtctgggaagtatgacctggacttcaagtctcccgatgaccccagcaggtacatctcgcctgaccagctggctgacctgtacaagtccttcatcaaggactacccagtggtgtctatcgaagatccctttgaccaggatgactggggagcttggcagaagttcacagccagtgcaggaatccaggtagtgggggatgatctcacagtgaccaacccaaagaggatcgccaaggccgtgaacgagaagtcctgcaactgcctcctgctcaaagtcaaccagattggctccgtgaccgagtctcttcaggcgtgcaagctggcccaggccaatggttggggcgtcatggtgtctcatcgttcgggggagactgaagataccttcatcgctgacctggttgtggggctgtgcactgggcagatcaagactggtgccccttgccgatctgagcgcttggccaagtacaaccagctcctcagaattgaagaggagctgggcagcaaggctaagtttgccggcaggaacttcagaaaccccttggccaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleoporin 62kDa
- WD repeat domain 1
- protein S (alpha)
- ferredoxin 1-like

Buy ENO1-enolase 1, (alpha) Gene now

Add to cart