TXNRD2-thioredoxin reductase 2 Gene View larger

TXNRD2-thioredoxin reductase 2 Gene

PTXBC007489

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNRD2-thioredoxin reductase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TXNRD2-thioredoxin reductase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007489
Product type: DNA & cDNA
Ncbi symbol: TXNRD2
Origin species: Human
Product name: TXNRD2-thioredoxin reductase 2 Gene
Size: 2ug
Accessions: BC007489
Gene id: 10587
Gene description: thioredoxin reductase 2
Synonyms: SELZ; TR-BETA; TR3; TRXR2; thioredoxin reductase 2, mitochondrial; selenoprotein Z; thioredoxin reductase 3; thioredoxin reductase TR3; thioredoxin reductase beta; thioredoxin reductase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccaggcggcactgctgggaggcctgatccaagatgcccccaactatggctgggaggtggcccagcccgtgccgcatgactggaggaagatggcagaagctgttcaaaatcacgtgaaatccttgaactggggccaccgtgtccagcttcaggacagaaaagtcaagtactttaacatcaaagccagctttgttgacgagcacacggtttgcggcgttgccaaaggtgggaaagagattctgctgtcagccgatcacatcatcattgctactggagggcggccgagataccccacgcacatcgaaggtgccttggaatatggaatcacaagtgatgacatcttctggctgaaggaatcccctggaaaaacgttggtggtcggggccagctatgtggccctggagtgtgctggcttcctcaccgggattgggctggacaccaccatcatgatgcgcagcatccccctccgcggcttcgaccagcaaatgtcctccatggtcatagagcacatggcatctcatggcacccggttcctgaggggctgtgccccctcgcgggtcaggaggctccctgatggccagctgcaggtcacctgggaggacagcaccaccggcaaggaggacacgggcacctttgacaccgtcctgtgggccataggtcgagtcccagacaccagaagtctgaatttggagaaggctggggtagatactagccccgacactcagaagatcctggtggactcccgggaagccacctctgtgccccacatctacgccattggtgacgtggtggaggggcggcctgagctgacacccatagcgatcatggccgggaggctcctggtgcagcggctcttcggcgggtcctcagatctgatggactacgacaatgttcccacgaccgtcttcaccccgctggagtatggctgtgtggggctgtccgaggaggaggcagtggctcgccacgggcaggagcatgttgaggtctatcacgcccattataaaccactggagttcacggtggctggacgagatgcatcccagtgttatgtaaagatggtgtgcctgagggagcccccacagctggtgctgggcctgcatttccttggccccaacgcaggcgaagttactcaaggatttgctctggggatcaagtgtggggcttcctatgcgcaggtgatgcggaccgtgggtatccatcccacatgctctgaggaggtagtcaagctgcgcatctccaagcgctcaggcctggaccccacggtgacaggctgctgagggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PCTAIRE protein kinase 1
- zinc finger protein 207
- PCTAIRE protein kinase 3
- FtsJ homolog 3 (E. coli)

Buy TXNRD2-thioredoxin reductase 2 Gene now

Add to cart