PCTK1-PCTAIRE protein kinase 1 Gene View larger

PCTK1-PCTAIRE protein kinase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCTK1-PCTAIRE protein kinase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCTK1-PCTAIRE protein kinase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006190
Product type: DNA & cDNA
Ncbi symbol: PCTK1
Origin species: Human
Product name: PCTK1-PCTAIRE protein kinase 1 Gene
Size: 2ug
Accessions: BC006190
Gene id: 5127
Gene description: PCTAIRE protein kinase 1
Synonyms: PCTK1; PCTAIRE; PCTAIRE1; PCTGAIRE; cyclin-dependent kinase 16; PCTAIRE-motif protein kinase 1; cell division protein kinase 16; serine/threonine-protein kinase PCTAIRE-1; testis secretory sperm-binding protein Li 224n; cyclin dependent kinase 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcggatgaagaagatcaaacggcagctgtcaatgacactcagctctgcaccagagattgtgcacgaggacttgaagatggggtctgatggggagagtgaccaggcttcagccacgtcctcggatgaggtgcagtctccagtgagagtgcgtatgcgcaaccatcccccacgcaagatctccactgaggacatcaacaagcgcctatcactaccagctgacatccggctgcctgagggctacctggagaagctgaccctcaatagccccatctttgacaagcccctcagccgccgcctccgtcgtgtcagcctatctgagattggctttgggaaactggagacctacattaagctggacaaactgggcgagggtacctatgccaccgtctacaaaggcaaaagcaagctcacagacaaccttgtggcactcaaggagatcagactggaacatgaagagggggcaccctgcaccgccatccgggaagtgtccctgctcaaggacctcaaacacgccaacatcgttacgctacatgacattatccacacggagaagtccctcacccttgtctttgagtacctggacaaggacctgaagcagtacctggatgactgtgggaacatcatcaacatgcacaacgtgaaactgttcctgttccagctgctccgtggcctggcctactgccaccggcagaaggtgctacaccgagacctcaagccccagaacctgctcatcaacgagaggggagagctcaagctggctgactttggcctggcccgagccaagtcaatcccaacaaagacatactccaatgaggtggtgacactgtggtaccggccccctgacatcctgcttgggtccacggactactccactcagattgacatgtggggtgtgggctgcatcttctatgagatggccacaggccgtcccctctttccgggctccacggtggaggaacagctacacttcatcttccgtatcttaggaaccccaactgaggagacgtggccaggcatcctgtccaacgaggagttcaagacatacaactaccccaagtaccgagccgaggcccttttgagccacgcaccccgacttgatagcgacggggccgacctcctcaccaagctgttgcagtttgagggtcgaaatcggatctccgcagaggatgccatgaaacatccattcttcctcagtctgggggagcggatccacaaacttcctgacactacttccatatttgcactaaaggagattcagctacaaaaggaggccagccttcggtcttcgtcgatgcctgactcaggcaggccagctttccgcgtggtggacaccgagttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 207
- PCTAIRE protein kinase 3
- FtsJ homolog 3 (E. coli)
- zinc finger protein 503

Buy PCTK1-PCTAIRE protein kinase 1 Gene now

Add to cart