NEU1-sialidase 1 (lysosomal sialidase) Gene View larger

NEU1-sialidase 1 (lysosomal sialidase) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEU1-sialidase 1 (lysosomal sialidase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NEU1-sialidase 1 (lysosomal sialidase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000722
Product type: DNA & cDNA
Ncbi symbol: NEU1
Origin species: Human
Product name: NEU1-sialidase 1 (lysosomal sialidase) Gene
Size: 2ug
Accessions: BC000722
Gene id: 4758
Gene description: sialidase 1 (lysosomal sialidase)
Synonyms: NANH; NEU; SIAL1; sialidase-1; G9 sialidase; N-acetyl-alpha-neuraminidase 1; acetylneuraminyl hydrolase; exo-alpha-sialidase; lysosomal sialidase; sialidase 1 (lysosomal sialidase); neuraminidase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactggggagcgacccagcacggcgctcccggacagacgctgggggccgcggattctgggcttctggggaggctgtagggtttgggtgtttgccgcgatcttcctgctgctgtctctggcagcctcctggtccaaggctgagaacgacttcggtctggtgcagccgctggtgaccatggagcaactgctgtgggtgagcgggagacagatcggctcagtggacaccttccgcatcccgctcatcacagccactccgcggggcactcttctcgcctttgctgaggcgaggaaaatgtcctcatccgatgagggggccaagttcatcgccctgcggaggtccatggaccagggcagcacatggtctcctacagcgttcattgtcaatgatggggatgtccccgatgggctgaaccttggggcagtagtgagcgatgttgagacaggagtagtatttcttttctactccctttgtgctcacaaggccggctgccaggtggcctctaccatgttggtatggagcaaggatgatggtgtttcctggagcacaccccggaatctctccctggatattggcactgaagtgtttgcccctggaccgggctctggtattcagaaacagcgggagccacggaagggccgcctcatcgtgtgtggccatgggacgctggagcgggacggagtcttctgtctcctcagcgatgatcatggtgcctcctggcgctacggaagtggggtcagcggcatcccctacggtcagcccaagcaggaaaatgatttcaatcctgatgaatgccagccctatgagctcccagatggctcagtcgtcatcaatgcccgaaaccagaacaactaccactgccactgccgaattgtcctccgcagctatgatgcctgtgatacactaaggccccgtgatgtgaccttcgaccctgagctcgtggaccctgtggtagctgcaggagctgtagtcaccagctccggcattgtcttcttctccaacccagcacatccagagttccgagtgaacctgaccctgcgatggagcttcagcaatggtacctcatggcggaaagagacagtccagctatggccaggccccagtggctattcatccctggcaaccctggagggcagcatggatggagaggagcaggccccccagctctacgtcctgtatgagaaaggccggaaccactacacagagagcatctccgtggccaaaatcagtgtctatgggacactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myotubularin related protein 14
- glutaryl-Coenzyme A dehydrogenase
- ceroid-lipofuscinosis, neuronal 3
- carboxypeptidase N, polypeptide 1

Buy NEU1-sialidase 1 (lysosomal sialidase) Gene now

Add to cart