Login to display prices
Login to display prices
CPN1-carboxypeptidase N, polypeptide 1 Gene View larger

CPN1-carboxypeptidase N, polypeptide 1 Gene

PTXBC027897

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPN1-carboxypeptidase N, polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPN1-carboxypeptidase N, polypeptide 1 Gene

Proteogenix catalog: PTXBC027897
Ncbi symbol: CPN1
Product name: CPN1-carboxypeptidase N, polypeptide 1 Gene
Size: 2ug
Accessions: BC027897
Gene id: 1369
Gene description: carboxypeptidase N, polypeptide 1
Synonyms: CPN; SCPN; carboxypeptidase N catalytic chain; anaphylatoxin inactivator; arginine carboxypeptidase; carboxypeptidase K; carboxypeptidase N catalytic subunit; carboxypeptidase N polypeptide 1 50 kD; carboxypeptidase N small subunit; carboxypeptidase N, polypeptide 1; kininase I; kininase-1; lysine carboxypeptidase; plasma carboxypeptidase B; serum carboxypeptidase N; carboxypeptidase N subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagacctgctctcagtcttcctccacctcctccttctcttcaagttggttgccccggtgacctttcgccaccaccgctatgatgatcttgtgcggacgctgtacaaggtgcaaaacgaatgccccggcatcacgcgggtctacagcattgggcgcagcgtggaggggagacacctctacgtgctggagttcagcgaccaccctggaatccacgagcccttggaaccagaggtcaagtatgtggggaacatgcacggcaacgaagcgttgggccgcgagctgatgctgcagctgtcggagtttctgtgcgaggagttccggaacaggaaccagcgcatcgtccagctcatccaggacacgcgcattcacatcctgccatccatgaaccccgacggctacgaggtggctgctgcccagggcccaaacaagcctgggtatctagttggcaggaacaatgcaaatggagtggacctgaaccgcaacttccctgatctcaatacctatatctactataacgagaagtacggaggccccaaccaccacctgccccttccagacaactggaaaagtcaggtggaacccgagacccgggcggtgatccggtggatgcactccttcaactttgttctttcagccaatctccacggaggggcggtggtggccaattacccgtatgacaagtcctttgagcaccgggtccgaggggtccgccgcaccgccagcacccccacgcctgacgacaagctcttccagaagctggccaaggtctactcctatgcacatggatggatgttccaaggttggaactgcggagattacttcccagatggcatcaccaatggagcttcctggtattctctcagcaagggaatgcaagactttaattatctccataccaactgctttgagatcacgctggaactgagttgcgacaagtttccccccgaagaggagttacagcgggagtggctgggtaatcgggaagccctaatccagttcctggaacaggttcaccagggcatcaagggaatggtgcttgatgagaattacaataatctcgccaatgctgtcatttctgtcagtgggattaaccatgatgtcacttcaggtgaccatggtgattacttccggctgctgcttccaggtatctacactgttagtgccacagcacctgggtatgacccagagacagtaactgtgaccgtgggtcctgcggaaccaacgttggttaacttccacctcaaaagaagcatccctcaagtaagccctgtgaggagagctcccagcagaaggcacggagtcagagccaaagtgcagccccaagccagaaagaaagaaatggagatgaggcagctgcagagaggccctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: