PLEKHA1-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene View larger

PLEKHA1-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene

PTXBC001136

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHA1-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHA1-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001136
Product type: DNA & cDNA
Ncbi symbol: PLEKHA1
Origin species: Human
Product name: PLEKHA1-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene
Size: 2ug
Accessions: BC001136
Gene id: 59338
Gene description: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Synonyms: pleckstrin homology domain-containing family A member 1; pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1; tandem PH domain-containing protein 1; pleckstrin homology domain containing A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttatgtggatcgtcagaatcgcatttgtggttttctagacattgaagaaaatgaaaacagtgggaaatttcttcgaaggtacttcatactggataccagagaagatagtttcgtgtggtacatggataatccacagaacctaccttctggatcatcacgtgttggagccattaagcttacctacatttcaaaggttagcgatgctactaagctaaggccaaaggcggagttctgttttgttatgaatgcaggaatgaggaagtacttcctacaagccaatgatcagcaggacctagtggaatgggtaaatgtgttaaacaaagctataaaaattacagtaccaaagcagtcagactcacagcctaattctgataacctaagtcgccatggtgaatgtgggaaaaagcaagtgtcttacagaactgatattgttggtggcgtacccatcattactcccactcagaaagaagaagtaaatgaatgtggtgaaagtattgacagaaataatctgaaacggtcacaaagccatcttccttactttactcctaaaccacctcaagatagtgcggttatcaaagctggatattgtgtaaaacaaggagcagtgatgaaaaactggaagagaagatattttcaattggatgaaaacacaataggctacttcaaatctgaactggaaaaggaacctcttcgcgtaataccacttaaagaggttcataaagtccaggaatgtaagcaaagcgacataatgatgagggacaacctctttgaaattgtaacaacgtctcgaactttctatgtgcaggctgatagccctgaagagatgcacagttggattaaagcagtctctggcgccattgtagcacagcggggtcccggcagatctgcgtcttctgagcatccccccggtccttcagaatccaaacacgctttccgtcctaccaacgcagccaccgccacctcacattccacagcctctcgcagcaactctttggtctcaacctttaccatggagaagcgaggattttacgagtctcttgccaaggtcaagccagggaacttcaaggtccagactgtctctccaagagaaccagcttccaaagtgactgaacaagctctgttaagacctcaaagtaaaaatggccctcaggaaaaagattgtgacctagtagacttggacgatgcgagccttccggtcagtgacgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
- 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
- pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3

Buy PLEKHA1-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene now

Add to cart