ADIPOR1-adiponectin receptor 1 Gene View larger

ADIPOR1-adiponectin receptor 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADIPOR1-adiponectin receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ADIPOR1-adiponectin receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001594
Product type: DNA & cDNA
Ncbi symbol: ADIPOR1
Origin species: Human
Product name: ADIPOR1-adiponectin receptor 1 Gene
Size: 2ug
Accessions: BC001594
Gene id: 51094
Gene description: adiponectin receptor 1
Synonyms: ACDCR1; CGI-45; CGI45; PAQR1; TESBP1A; adiponectin receptor protein 1; progestin and adipoQ receptor family member I; adiponectin receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttcccacaaaggatctgtggtggcacaggggaatggggctcctgccagtaacagggaagctgacacggtggaactggctgaactgggacccctgctagaagagaagggcaaacgggtaatcgccaacccacccaaagctgaagaagagcaaacatgcccagtgccccaggaagaagaggaggaggtgcgggtactgacacttcccctgcaagcccaccacgccatggagaagatggaagagtttgtgtacaaggtctgggagggacgttggagggtcatcccatatgatgtgctccctgactggctaaaggacaacgactatctgctacatggtcatagacctcccatgccctcctttcgggcttgcttcaagagcatcttccgcattcatacagaaactggcaacatctggacccatctgcttggtttcgtgctgtttctctttttgggaatcttgaccatgctcagaccaaatatgtacttcatggcccctctacaggagaaggtggtttttgggatgttctttttgggtgcagtgctctgcctcagcttctcctggctctttcacaccgtctattgtcattcagagaaagtctctcggactttttccaaactggactattcagggattgctcttctaattatggggagctttgtcccctggctctattattccttctactgctccccacagccacggctcatctacctctccatcgtctgtgtcctgggcatttctgccatcattgtggcgcagtgggaccggtttgccactcctaagcaccggcagacaagagcaggcgtgttcctgggacttggcttgagtggcgtcgtgcccaccatgcactttactatcgctgagggctttgtcaaggccaccacagtgggccagatgggctggttcttcctcatggctgtgatgtacatcactggagctggcctttatgctgctcgaattcctgagcgcttctttcctggaaaatttgacatatggttccagtctcatcagattttccatgtcctggtggtggcagcagcctttgtccacttctatggagtctccaaccttcaggaattccgttacggcctagaaggcggctgtactgatgacacccttctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DDHD domain containing 2
- cyclin G associated kinase
- zinc finger protein 446
- thioredoxin reductase 2

Buy ADIPOR1-adiponectin receptor 1 Gene now

Add to cart