CDK9-cyclin-dependent kinase 9 Gene View larger

CDK9-cyclin-dependent kinase 9 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDK9-cyclin-dependent kinase 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDK9-cyclin-dependent kinase 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001968
Product type: DNA & cDNA
Ncbi symbol: CDK9
Origin species: Human
Product name: CDK9-cyclin-dependent kinase 9 Gene
Size: 2ug
Accessions: BC001968
Gene id: 1025
Gene description: cyclin-dependent kinase 9
Synonyms: C-2k; CDC2L4; CTK1; PITALRE; TAK; cyclin-dependent kinase 9; CDC2-related kinase; cell division cycle 2-like protein kinase 4; cell division protein kinase 9; serine/threonine protein kinase PITALRE; tat-associated kinase complex catalytic subunit; cyclin dependent kinase 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaagcagtacgactcggtggagtgccctttttgtgatgaagtttccaaatacgagaagctcgccaagatcggccaaggcaccttcggggaggtgttcaaggccaggcaccgcaagaccggccagaaggtggctctgaagaaggtgctgatggaaaacgagaaggaggggttccccattacagccttgcgggagatcaagatccttcagcttctaaaacacgagaatgtggtcaacttgattgagatttgtcgaaccaaagcttccccctataaccgctgcaagggtagtatatacctggtgttcgacttctgcgagcatgaccttgctgggctgttgagcaatgttttggtcaagttcacgctgtctgagatcaagagggtgatgcagatgctgcttaacggcctctactacatccacagaaacaagatcctgcatagggacatgaaggctgctaatgtgcttatcactcgtgatggggtcctgaagctggcagactttgggctggcccgggccttcagcctggccaagaacagccagcccaaccgctacaccaaccgtgtggtgacactctggtaccggcccccggagctgttgctcggggagcgggactacggcccccccattgacctgtggggtgctgggtgcatcatggcagagatgtggacccgcagccccatcatgcagggcaacacggagcagcaccaactcgccctcatcagtcagctctgcggctccatcacccctgaggtgtggccaaacgtggacaactatgagctgtacgaaaagctggagctggtcaagggccagaagcggaaggtgaaggacaggctgaaggcctatgtgcgtgacccatacgcactggacctcatcgacaagctgctggtgctggaccctgcccagcgcatcgacagcgatgacgccctcaaccacgacttcttctggtccgaccccatgccctccgacctcaagggcatgctctccacccacctgacgtccatgttcgagtacttggcaccaccgcgccggaagggcagccagatcacccagcagtccaccaaccagagtcgcaatcccgccaccaccaaccagacggagtttgagcgcgtcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adiponectin receptor 1
- DDHD domain containing 2
- cyclin G associated kinase
- zinc finger protein 446

Buy CDK9-cyclin-dependent kinase 9 Gene now

Add to cart