Login to display prices
Login to display prices
CDK9-cyclin-dependent kinase 9 Gene View larger

CDK9-cyclin-dependent kinase 9 Gene

PTXBC001968

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDK9-cyclin-dependent kinase 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDK9-cyclin-dependent kinase 9 Gene

Proteogenix catalog: PTXBC001968
Ncbi symbol: CDK9
Product name: CDK9-cyclin-dependent kinase 9 Gene
Size: 2ug
Accessions: BC001968
Gene id: 1025
Gene description: cyclin-dependent kinase 9
Synonyms: C-2k; CDC2L4; CTK1; PITALRE; TAK; cyclin-dependent kinase 9; CDC2-related kinase; cell division cycle 2-like protein kinase 4; cell division protein kinase 9; serine/threonine protein kinase PITALRE; tat-associated kinase complex catalytic subunit; cyclin dependent kinase 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaagcagtacgactcggtggagtgccctttttgtgatgaagtttccaaatacgagaagctcgccaagatcggccaaggcaccttcggggaggtgttcaaggccaggcaccgcaagaccggccagaaggtggctctgaagaaggtgctgatggaaaacgagaaggaggggttccccattacagccttgcgggagatcaagatccttcagcttctaaaacacgagaatgtggtcaacttgattgagatttgtcgaaccaaagcttccccctataaccgctgcaagggtagtatatacctggtgttcgacttctgcgagcatgaccttgctgggctgttgagcaatgttttggtcaagttcacgctgtctgagatcaagagggtgatgcagatgctgcttaacggcctctactacatccacagaaacaagatcctgcatagggacatgaaggctgctaatgtgcttatcactcgtgatggggtcctgaagctggcagactttgggctggcccgggccttcagcctggccaagaacagccagcccaaccgctacaccaaccgtgtggtgacactctggtaccggcccccggagctgttgctcggggagcgggactacggcccccccattgacctgtggggtgctgggtgcatcatggcagagatgtggacccgcagccccatcatgcagggcaacacggagcagcaccaactcgccctcatcagtcagctctgcggctccatcacccctgaggtgtggccaaacgtggacaactatgagctgtacgaaaagctggagctggtcaagggccagaagcggaaggtgaaggacaggctgaaggcctatgtgcgtgacccatacgcactggacctcatcgacaagctgctggtgctggaccctgcccagcgcatcgacagcgatgacgccctcaaccacgacttcttctggtccgaccccatgccctccgacctcaagggcatgctctccacccacctgacgtccatgttcgagtacttggcaccaccgcgccggaagggcagccagatcacccagcagtccaccaaccagagtcgcaatcccgccaccaccaaccagacggagtttgagcgcgtcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: