Login to display prices
Login to display prices
WDR45-WD repeat domain 45 Gene View larger

WDR45-WD repeat domain 45 Gene

PTXBC000464

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR45-WD repeat domain 45 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR45-WD repeat domain 45 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000464
Product type: DNA & cDNA
Ncbi symbol: WDR45
Origin species: Human
Product name: WDR45-WD repeat domain 45 Gene
Size: 2ug
Accessions: BC000464
Gene id: 11152
Gene description: WD repeat domain 45
Synonyms: JM5; NBIA4; NBIA5; WDRX1; WIPI-4; WIPI4; WD repeat domain phosphoinositide-interacting protein 4; WD repeat domain, X-linked 1; WD repeat-containing protein 45; WD45 repeat protein interacting with phosphoinositides 4; neurodegeneration with brain iron accumulation 4; neurodegeneration with brain iron accumulation 5; WD repeat domain 45
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcaacagccacttcgaggagtgaccagcctgcgtttcaaccaagaccaaagctgcttttgctgcgccatggagacaggtgtgcgcatctacaacgtggagcccttgatggagaaggggcatctggaccacgagcaggtgggcagcatgggcttggtggagatgctgcaccgctccaaccttctggccttggtgggcggtggtagtagtcccaagttctcagagatctcagtgctgatctgggacgatgcccgggagggcaaggactccaaggagaagctggtgctggagttcaccttcaccaagccagtgctttctgtgcgcatgcgccatgacaagatcgtgatcgtgctgaagaaccgcatctatgtgtactccttccccgacaatccccgaaagctgtttgagtttgatacccgggacaaccccaaggggctctgtgacctctgccccagcctggagaagcaactgctagtgttcccgggacacaagtgtgggagtctgcaacttgtggacctggcgagcacaaagcctggcacctcgtctgctccattcacgatcaatgcacatcagagtgacatagcctgtgtgtctctaaaccagccaggcactgtagtggcctcagcctcccagaagggtacccttattcgcctctttgacacacaatccaaggagaaactggtggagctgcgccgaggcactgaccctgccaccctctactgcattaacttcagccacgactcctccttcctctgcgcttccagtgataagggtactgtccatatctttgctctcaaggatacccgcctcaaccgccgctccgcgctggctcgcgtgggcaaggtggggcctatgattgggcagtacgtggactctcagtggagcctggcgagcttcactgtgcctgctgagtcagcttgcatctgcgccttcggtcgcaatacttccaagaacgtcaactctgtcattgccatctgcgtagatgggaccttccacaaatatgtcttcactcctgatggaaactgcaacagagaggctttcgacgtgtaccttgacatctgtgatgatgatgacttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lipoyltransferase 1
- lipoyltransferase 1
- chitinase 3-like 2
- ribosomal protein L3