Login to display prices
Login to display prices
LIPT1-lipoyltransferase 1 Gene View larger

LIPT1-lipoyltransferase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LIPT1-lipoyltransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LIPT1-lipoyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009772
Product type: DNA & cDNA
Ncbi symbol: LIPT1
Origin species: Human
Product name: LIPT1-lipoyltransferase 1 Gene
Size: 2ug
Accessions: BC009772
Gene id: 51601
Gene description: lipoyltransferase 1
Synonyms: LIPT1D; lipoyltransferase 1, mitochondrial; lipoate biosynthesis protein; lipoyl ligase; lipoyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgatcccattttcaatgaagaattgcttccagttactttgtaactgccaggtcccagcagctggctttaaaaaaacagtaaaaaatgggctcattttacagtcaatttccaatgatgtctatcaaaatctggctgtggaagactggatccatgaccatatgaatctagaaggcaaaccaattctattcttttggcagaattctccctctgttgtaattggtaggcatcaaaatccttggcaggaatgtaacctgaatctaatgagagaagaaggtataaaactggctcggagaagaagtggaggaggaacagtctaccatgatatgggtaatatcaatttgactttctttacaaccaaaaaaaagtatgatagaatggaaaatctgaaattaattgtgagagctctgaatgctgtccaaccccagctggatgtgcaggctaccaaaagatttgaccttttacttgatggacagtttaaaatctcaggaacagcttctaagatcggccggactactgcctatcaccattgcactttattatgtagtactgatgggacgttcttgtcttctttgctaaagagcccttaccaagggatcaggagcaatgccactgctagcataccttccttagtgaaaaatcttttggaaaaggatcccactctgacctgtgaagtactaatgaatgctgttgctacagagtatgctgcttatcatcaaattgataatcacattcacctaataaacccaacggatgagacactgtttcctggaataaatagcaaagccaaagaactgcaaacttgggagtggatatatggcaaaactccaaagtttagtataaatacttcctttcatgtgttatatgaacagtcacacttggaaattaaagtattcatagacataaagaatggaagaattgaaatttgtaatattgaagcacctgatcattggttgccattggaaatacgtgacaaattaaattcaagtcttattggcagtaagttttgcccaactgaaactaccatgctaacaaatatattacttagaacatgtccacaagaccacaaactaaacagtaaatggaatattctctgtgaaaaaattaagggaataatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chitinase 3-like 2
- ribosomal protein L3
- ribosomal protein L3
- WD repeat domain 85