Login to display prices
Login to display prices
WDR5-WD repeat domain 5 Gene View larger

WDR5-WD repeat domain 5 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR5-WD repeat domain 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WDR5-WD repeat domain 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001635
Product type: DNA & cDNA
Ncbi symbol: WDR5
Origin species: Human
Product name: WDR5-WD repeat domain 5 Gene
Size: 2ug
Accessions: BC001635
Gene id: 11091
Gene description: WD repeat domain 5
Synonyms: BIG-3; CFAP89; SWD3; WD repeat-containing protein 5; BMP2-induced 3-kb gene protein; SWD3, Set1c WD40 repeat protein, homolog; cilia and flagella associated protein 89; WD repeat domain 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacggaggagaagaagcccgagaccgaggccgccagagcacagccaaccccttcgtcatccgccactcagagcaagcctacacctgtgaagccaaactatgctctaaagttcacccttgctggccacaccaaagcagtgtcctccgtgaaattcagcccgaatggagagtggctggcaagttcatctgctgataaacttattaaaatttggggcgcgtatgatgggaaatttgagaaaaccatatctggtcacaagctgggaatatccgatgtagcctggtcgtcagattctaaccttcttgtttctgcctcagatgacaaaaccttgaagatatgggacgtgagctcgggcaagtgtctgaaaaccctgaagggacacagtaattatgtcttttgctgcaacttcaatccccagtccaaccttattgtctcaggatcctttgacgaaagcgtgaggatatgggatgtgaaaacagggaagtgcctcaagactttgccagctcactcggatccagtctcggccgttcattttaatcgtgatggatccttgatagtttcaagtagctatgatggtctctgtcgcatctgggacaccgcctcgggccagtgcctgaagacgctcatcgatgacgacaacccccccgtgtcttttgtgaagttctccccgaacggcaaatacatcctggccgccacgctggacaacactctgaagctctgggactacagcaaggggaagtgcctgaagacgtacactggccacaagaatgagaaatactgcatatttgccaatttctctgttactggtgggaagtggattgtgtctggctcagaggataaccttgtttacatctggaaccttcagacgaaagagattgtacagaaactacaaggccacacagatgtcgtgatctcaacagcttgtcacccaacagaaaacatcatcgcctctgctgcgctagaaaatgacaaaacaattaaactgtggaagagtgactgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GNAS complex locus
- GNAS complex locus
- nuclear factor I/B
- enolase 1, (alpha)