SLC25A6-solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 Gene View larger

SLC25A6-solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 Gene

PTXBC031912

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A6-solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A6-solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031912
Product type: DNA & cDNA
Ncbi symbol: SLC25A6
Origin species: Human
Product name: SLC25A6-solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 Gene
Size: 2ug
Accessions: BC031912
Gene id: 293
Gene description: solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6
Synonyms: AAC3; ANT; ANT 2; ANT 3; ANT3; ANT3Y; ADP/ATP translocase 3; ADP,ATP carrier protein; ADP,ATP carrier protein 3; ADP,ATP carrier protein, liver; ADP/ATP translocator of liver; adenine nucleotide translocator 3; solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6; solute carrier family 25 member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgtccgcatccccaaggagcagggcgtgctgtccttctggaggggcaaccttgccaacgtcattcgctacttccccactcaagccctcaacttcgccttcaaggataagtacaagcagatcttcctggggggcgtggacaagcacacgcagttctggaggtactttgcgggcaacctggcctccggcggtgcggccggcgcgacctccctctgcttcgtgtacccgctggattttgccagaacccgcctggcagcggacgtgggaaagtcaggcacagagcgcgagttccgaggcctgggagactgcctggtgaagatcaccaagtccgacggcatccggggcctgtaccagggcttcagtgtctccgtgcagggcatcatcatctaccgggcggcctacttcggcgtgtacgatacggccaagggcatgctccccgaccccaagaacacgcacatcgtggtgagctggatgatcgcgcagaccgtgacggccgtggccggcgtggtgtcctaccccttcgacacggtgcggcggcgcatgatgatgcagtccgggcgcaaaggagctgacatcatgtacacgggcaccgtcgactgttggaggaagatcttcagagatgaggggggcaaggccttcttcaagggtgcgtggtccaacgtcctgcggggcatggggggcgccttcgtgctggtcctgtacgacgagctcaagaaggtgatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
- 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
- 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
- solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4

Buy SLC25A6-solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 Gene now

Add to cart