AGPAT2-1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) Gene View larger

AGPAT2-1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) Gene

PTXBC000026

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGPAT2-1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AGPAT2-1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000026
Product type: DNA & cDNA
Ncbi symbol: AGPAT2
Origin species: Human
Product name: AGPAT2-1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) Gene
Size: 2ug
Accessions: BC000026
Gene id: 10555
Gene description: 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
Synonyms: 1-AGPAT2; BSCL; BSCL1; LPAAB; LPAAT-beta; 1-acyl-sn-glycerol-3-phosphate acyltransferase beta; 1-AGP acyltransferase 2; 1-AGPAT 2; 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta); lysophosphatidic acid acyltransferase-beta; testicular tissue protein Li 143; 1-acylglycerol-3-phosphate O-acyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgtggccgtgtctggccgcggcgctgctgttgctgctgctgctggtgcagctgagccgcgcggccgagttctacgccaaggtcgccctgtactgcgcgctgtgcttcacggtgtccgccgtggcctcgctcgtctgcctgctgcgccacggcggccggacggtggagaacatgagcatcatcggctggttcgtgcgaagcttcaagtacttttacgggctccgcttcgaggtgcgggacccgcgcaggctgcaggaggcccgtccctgtgtcatcgtctccaaccaccagagcatcctggacatgatgggcctcatggaggtccttccggagcgctgcgtgcagatcgccaagcgggagctgctcttcctggggcccgtgggcctcatcatgtacctcgggggcgtcttcttcatcaaccggcagcgctctagcactgccatgacagtgatggccgacctgggcgagcgcatggtcagggagaacctcaaagtgtggatctatcccgagggtactcgcaacgacaatggggacctgctgccttttaagaagggcgccttctacctggcagtccaggcacaggtgcccatcttccccgtggtgtactcttccttctcctccttctacaacaccaagaagaagttcttcacttcaggaacagtcacagtgcaggtgctggaagccatccccaccagcggcctcactgcggcggacgtccctgcgctcgtggacacctgccaccgggccatgaggaccaccttcctccacatctccaagaccccccaggagaacggggccactgcggggtctggcgtgcagccggcccagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
- solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6
- solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6
- sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F

Buy AGPAT2-1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) Gene now

Add to cart