RPS2-ribosomal protein S2 Gene View larger

RPS2-ribosomal protein S2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS2-ribosomal protein S2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS2-ribosomal protein S2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012354
Product type: DNA & cDNA
Ncbi symbol: RPS2
Origin species: Human
Product name: RPS2-ribosomal protein S2 Gene
Size: 2ug
Accessions: BC012354
Gene id: 6187
Gene description: ribosomal protein S2
Synonyms: LLREP3; 40S ribosomal protein S2; 40S ribosomal protein S4; OK/KNS-cl.6; protein LLRep3; ribosomal protein S2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatgacgccggtgcagcgggggggcccggaggccctggtggccctgggatggggaaccgcggtggcttccgcggaggtttcggcagtggcattcggggccggggtcgcggccgtggacggggccggggccgaggccgcggagctcgcggaggcaaggccgaggataaggagtggatgcccgtcaccaagttgggccgcttggtcaaggacatgaagatcaagtccctggaggagatctatctcttctccctgcccattaaggaatcagagatcattgatttcttcctgggggcctctctcaaggatgaggttttgaagattatgccagtgcagaagcagacccgtgccggccagcgcaccaggttcaaggcatttgttgctatcggggactacaatggccacgtcggtctgggtgttaagtgctccaaggaggtggccaccgccatccgtggggccatcatcctggccaagctctccatcgtccccgtgcgcagaggctactgggggaacaagatcggcaagccccacactgtcccttgcaaggtgacaggccgctgcggctctgtgctggtacgcctcatccctgcacccaggggcactggcatcgtctccgcacctgtgcctaagaagctgctcatgatggctggtatcgatgactgctacacctcagcccggggctgcactgccaccctgggcaacttcgccaaggccacctttgatgccatttctaagacctacagctacctgacccccgacctctggaaggagactgtattcaccaagtctccctatcaggagttcactgaccacctcgtcaagacccacaccagagtctccgtgcagcggactcaggctccagctgtggctacaacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein SA
- jun B proto-oncogene
- WD repeat domain 45
- lipoyltransferase 1

Buy RPS2-ribosomal protein S2 Gene now

Add to cart