CDK5-cyclin-dependent kinase 5 Gene View larger

CDK5-cyclin-dependent kinase 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDK5-cyclin-dependent kinase 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDK5-cyclin-dependent kinase 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005115
Product type: DNA & cDNA
Ncbi symbol: CDK5
Origin species: Human
Product name: CDK5-cyclin-dependent kinase 5 Gene
Size: 2ug
Accessions: BC005115
Gene id: 1020
Gene description: cyclin-dependent kinase 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaaatacgagaaactggaaaagattggggaaggcacctacggaactgtgttcaaggccaaaaaccgggagactcatgagatcgtggctctgaaacgggtgaggctggatgacgatgatgagggtgtgccgagttccgccctccgggagatctgcctactcaaggagctgaagcacaagaacatcgtcaggcttcatgacgtcctgcacagcgacaagaagctgactttggtttttgaattctgtgaccaggacctgaagaagtattttgacagttgcaatggtgacctcgatcctgagattgtaaagtcattcctcttccagctactaaaagggctgggattctgtcatagccgcaatgtgctacacagggacctgaagccccagaacctgctaataaacaggaatggggagctgaaattggctgattttggcctggctcgagcctttgggattcccgtccgctgttactcagctgaggtggtcacactgtggtaccgcccaccggatgtcctctttggggccaagctgtactccacgtccatcgacatgtggtcagccggctgcatctttgcagagctggccaatgctgggcggcctctttttcccggcaatgatgtcgatgaccagttgaagaggatcttccgactgctggggacgcccaccgaggagcagtggccctctatgaccaagctgccagactataagccctatccgatgtacccggccacaacatccctggtgaacgtcgtgcccaaactcaatgccacagggagggatctgctgcagaaccttctgaagtgtaaccctgtccagcgtatctcagcagaagaggccctgcagcacccctacttctccgacttctgtccgccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - schlafen family member 5
- high-mobility group 20A
- formyl peptide receptor 1
- modulator of apoptosis 1

Buy CDK5-cyclin-dependent kinase 5 Gene now

Add to cart