HMG20A-high-mobility group 20A Gene View larger

HMG20A-high-mobility group 20A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMG20A-high-mobility group 20A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HMG20A-high-mobility group 20A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021959
Product type: DNA & cDNA
Ncbi symbol: HMG20A
Origin species: Human
Product name: HMG20A-high-mobility group 20A Gene
Size: 2ug
Accessions: BC021959
Gene id: 10363
Gene description: high-mobility group 20A
Synonyms: HMGX1; HMGXB1; high mobility group protein 20A; HMG box domain containing 1; HMG box-containing protein 20A; HMG domain-containing protein 1; HMG domain-containing protein HMGX1; high mobility group 20A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaacttgatgactagctccaccctaccgcccctttttgcagatgaagacggttccaaggagagtaatgatctggctaccactgggttaaatcacccagaggttccatacagtagtggcgccacatcatccaccaacaatccagaatttgtggaggatctctctcaaggtcagttgcttcagagtgagtcttcaaatgcagcagaaggcaatgaacagaggcatgaagatgagcaacgaagtaaacgaggaggttggtccaaaggaagaaagaggaagaaacctcttcgagacagcaatgcacccaaatccccccttacaggatatgttcggttcatgaatgagcgtcgagaacaacttcgagcaaagagaccagaagtcccatttccagaaatcacaaggatgttaggcaatgaatggagtaaactgcctcctgaggaaaaacagcgctaccttgatgaagcagacagagataaggagcgttacatgaaggaactggaacagtatcagaaaacagaggcctacaaggtcttcagtaggaaaacccaggaccgtcagaaaggcaaatctcataggcaagatgcagcccggcaggccactcatgatcatgagaaagaaacagaggtaaaggaacggtctgtttttgacatccctatatttacagaggaattcttgaaccatagcaaagctcgggaagcagagctccgccagcttcgcaaatccaacatggagtttgaggagaggaatgcagccctgcaaaagcacgtggagagcatgcgcacagcagtggagaagctggaggtggatgtgatccaggagcggagccgcaacacagtcttacagcagcacctggagaccctgcggcaggtgctgaccagcagctttgccagcatgcccttgcctggaagtggagagacacctacagtggacaccattgactcatatatgaacagactgcacagtattattttagctaatccccaagacaatgaaaacttcatagctacagttcgagaagttgtgaacagactcgatcgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - formyl peptide receptor 1
- modulator of apoptosis 1
- stomatin (EPB72)-like 2
- ring finger protein 146

Buy HMG20A-high-mobility group 20A Gene now

Add to cart