Login to display prices
Login to display prices
ASB9-ankyrin repeat and SOCS box-containing 9 Gene View larger

ASB9-ankyrin repeat and SOCS box-containing 9 Gene

PTXBC001244

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASB9-ankyrin repeat and SOCS box-containing 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ASB9-ankyrin repeat and SOCS box-containing 9 Gene

Proteogenix catalog: PTXBC001244
Ncbi symbol: ASB9
Product name: ASB9-ankyrin repeat and SOCS box-containing 9 Gene
Size: 2ug
Accessions: BC001244
Gene id: 140462
Gene description: ankyrin repeat and SOCS box-containing 9
Synonyms: ankyrin repeat and SOCS box protein 9; ASB-9; ankyrin repeat and suppressor of cytokine signaling box protein 9; testis tissue sperm-binding protein Li 57p; ankyrin repeat and SOCS box containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggcaaacaagggggcatggatgggagcaagcccgcggggccaagggactttcctggcatcaggcttctttcaaacccattgatgggcgatgctgtgtctgattggtctcctatgcatgaagctgcaatccacggacatcagctgtctctgaggaacctcatcagccaggggtgggctgtgaacatcatcacggcagatcatgtttccccactccatgaagcctgtcttggaggtcatctctcttgtgtgaagattttattaaagcatggagctcaggtgaatggtgtgacagcagactggcacactccactgtttaatgcttgtgtcagcggcagctgggattgtgtgaatttgcttctgcagcacggagccagcgttcaacctgagagtgatctggcatcccccatccatgaagctgctaggagagcttatgggggcaacattgaccataagatcagccacctgggcactccactctatttggcttgtgaaaaccaacagagagcctgtgtcaagaagcttctggagtcaggagcggacgtgaaccaagggaaaggtcaggattccccacttcatgcagtggccaggacagccagtgaagagctggcctgcctgctcatggattttggagcggacacccaggccaagaatgctgaaggcaaacgtcctgtggagctggtgcctccagagagccccttggcccagctcttcttggagagagaaggtgcttctttgccaaaacctaagccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: