PEX11A-peroxisomal biogenesis factor 11 alpha Gene View larger

PEX11A-peroxisomal biogenesis factor 11 alpha Gene

PTXBC009697

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX11A-peroxisomal biogenesis factor 11 alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEX11A-peroxisomal biogenesis factor 11 alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009697
Product type: DNA & cDNA
Ncbi symbol: PEX11A
Origin species: Human
Product name: PEX11A-peroxisomal biogenesis factor 11 alpha Gene
Size: 2ug
Accessions: BC009697
Gene id: 8800
Gene description: peroxisomal biogenesis factor 11 alpha
Synonyms: PEX11-ALPHA; PMP28; hsPEX11p; peroxisomal membrane protein 11A; 28 kDa peroxisomal integral membrane protein; peroxin-11A; peroxisomal biogenesis factor 11A; protein PEX11 homolog alpha; peroxisomal biogenesis factor 11 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgccttcacccgcttcaccaaccagacccagggccgggaccgactcttcagagccactcagtacacatgcatgttgcttagatatttgttagagcccaaagctggcaaagagaaggtggtaatgaagctcaagaaactggagtccagtgtgagcactggtcgtaaatggttcagactaggcaatgtggtacatgctatacaggcaactgagcagagcattcatgccactgacctggtacctcgcttatgcttaacattagccaacctgaaccgtgtgatttatttcatctgtgacaccatcctctgggtgaggagcgtaggtctcacctctggcatcaacaaagagaaatggcgaacgagggctgctcaccactactactattctcttctgctgagccttgtcagggatctgtatgaaatctccctgcagatgaaacgagttacatgtgacagggcaaagaaagagaaatcagcatcccaggatcctctttggttcagcgtggctgaggaggaaacagaatggctccaatcctttctacttcttttattccgatctctgaagcagcatcctcccttgctcctggacacagtgaagaacctttgtgatatcctgaaccctttggaccagctggggatctataaatccaatcctggcatcattggacttggaggtcttgtgtcctctatagcaggcatgatcactgtggcatatcctcagatgaagctgaagacccgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and SOCS box-containing 9
- inositol(myo)-1(or 4)-monophosphatase 1
- developmental pluripotency associated 2
- retinal outer segment membrane protein 1

Buy PEX11A-peroxisomal biogenesis factor 11 alpha Gene now

Add to cart