Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PEX11A-peroxisomal biogenesis factor 11 alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PEX11A-peroxisomal biogenesis factor 11 alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009697 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PEX11A |
| Origin species: | Human |
| Product name: | PEX11A-peroxisomal biogenesis factor 11 alpha Gene |
| Size: | 2ug |
| Accessions: | BC009697 |
| Gene id: | 8800 |
| Gene description: | peroxisomal biogenesis factor 11 alpha |
| Synonyms: | PEX11-ALPHA; PMP28; hsPEX11p; peroxisomal membrane protein 11A; 28 kDa peroxisomal integral membrane protein; peroxin-11A; peroxisomal biogenesis factor 11A; protein PEX11 homolog alpha; peroxisomal biogenesis factor 11 alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgccttcacccgcttcaccaaccagacccagggccgggaccgactcttcagagccactcagtacacatgcatgttgcttagatatttgttagagcccaaagctggcaaagagaaggtggtaatgaagctcaagaaactggagtccagtgtgagcactggtcgtaaatggttcagactaggcaatgtggtacatgctatacaggcaactgagcagagcattcatgccactgacctggtacctcgcttatgcttaacattagccaacctgaaccgtgtgatttatttcatctgtgacaccatcctctgggtgaggagcgtaggtctcacctctggcatcaacaaagagaaatggcgaacgagggctgctcaccactactactattctcttctgctgagccttgtcagggatctgtatgaaatctccctgcagatgaaacgagttacatgtgacagggcaaagaaagagaaatcagcatcccaggatcctctttggttcagcgtggctgaggaggaaacagaatggctccaatcctttctacttcttttattccgatctctgaagcagcatcctcccttgctcctggacacagtgaagaacctttgtgatatcctgaaccctttggaccagctggggatctataaatccaatcctggcatcattggacttggaggtcttgtgtcctctatagcaggcatgatcactgtggcatatcctcagatgaagctgaagacccgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat and SOCS box-containing 9 - inositol(myo)-1(or 4)-monophosphatase 1 - developmental pluripotency associated 2 - retinal outer segment membrane protein 1 |