CD69-CD69 molecule Gene View larger

CD69-CD69 molecule Gene

PTXBC007037

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD69-CD69 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD69-CD69 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007037
Product type: DNA & cDNA
Ncbi symbol: CD69
Origin species: Human
Product name: CD69-CD69 molecule Gene
Size: 2ug
Accessions: BC007037
Gene id: 969
Gene description: CD69 molecule
Synonyms: CD69 molecule; activation inducer molecule (AIM/CD69); CD69 antigen (p60, early T-cell activation antigen); early activation antigen CD69; AIM; BL-AC/P26; CLEC2C; EA1; GP32/28; MLR-3; C-type lectin domain family 2, member C; early T-cell activation antigen p60; early lymphocyte activation antigen; leukocyte surface antigen Leu-23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctctgaaaattgtttcgtagcagagaacagctctttgcatccggagagtggacaagaaaatgatgccaccagtccccatttctcaacacgtcatgaagggtccttccaagttcctgtcctgtgtgctgtaatgaatgtggtcttcatcaccattttaatcatagctctcattgccttatcagtgggccaatacaattgtccaggccaatacacattctcaatgccatcagacagccatgtttcttcatgctctgaggactgggttggctaccagaggaaatgctactttatttctactgtgaagaggagctggacttcagcccaaaatgcttgttctgaacatggtgctactcttgctgtcattgattctgaaaaggacatgaactttctaaaacgatacgcaggtagagaggaacactgggttggactgaaaaaggaacctggtcacccatggaagtggtcaaatggcaaagaatttaacaactggttcaacgttacagggtctgacaagtgtgtttttctgaaaaacacagaggtcagcagcatggaatgtgagaagaatttatactggatatgtaacaaaccttacaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tropomyosin 4
- prion protein
- prion protein
- bestrophin 3

Buy CD69-CD69 molecule Gene now

Add to cart