Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD69-CD69 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD69-CD69 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007037 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD69 |
| Origin species: | Human |
| Product name: | CD69-CD69 molecule Gene |
| Size: | 2ug |
| Accessions: | BC007037 |
| Gene id: | 969 |
| Gene description: | CD69 molecule |
| Synonyms: | CD69 molecule; activation inducer molecule (AIM/CD69); CD69 antigen (p60, early T-cell activation antigen); early activation antigen CD69; AIM; BL-AC/P26; CLEC2C; EA1; GP32/28; MLR-3; C-type lectin domain family 2, member C; early T-cell activation antigen p60; early lymphocyte activation antigen; leukocyte surface antigen Leu-23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctctgaaaattgtttcgtagcagagaacagctctttgcatccggagagtggacaagaaaatgatgccaccagtccccatttctcaacacgtcatgaagggtccttccaagttcctgtcctgtgtgctgtaatgaatgtggtcttcatcaccattttaatcatagctctcattgccttatcagtgggccaatacaattgtccaggccaatacacattctcaatgccatcagacagccatgtttcttcatgctctgaggactgggttggctaccagaggaaatgctactttatttctactgtgaagaggagctggacttcagcccaaaatgcttgttctgaacatggtgctactcttgctgtcattgattctgaaaaggacatgaactttctaaaacgatacgcaggtagagaggaacactgggttggactgaaaaaggaacctggtcacccatggaagtggtcaaatggcaaagaatttaacaactggttcaacgttacagggtctgacaagtgtgtttttctgaaaaacacagaggtcagcagcatggaatgtgagaagaatttatactggatatgtaacaaaccttacaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tropomyosin 4 - prion protein - prion protein - bestrophin 3 |