Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene
PTXBC005291
New product
Data sheet of EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005291 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EEF1E1 |
| Origin species: | Human |
| Product name: | EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene |
| Size: | 2ug |
| Accessions: | BC005291 |
| Gene id: | 9521 |
| Gene description: | eukaryotic translation elongation factor 1 epsilon 1 |
| Synonyms: | AIMP3; P18; eukaryotic translation elongation factor 1 epsilon-1; ARS-interacting multifunctional protein 3; aminoacyl tRNA synthetase complex-interacting multifunctional protein 3; multisynthase complex auxiliary component p18; p18 component of aminoacyl-tRNA synthetase complex; eukaryotic translation elongation factor 1 epsilon 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggccgcagagttgtcgctactggagaagtccctgggactgagtaaggggaataaatacagtgctcagggcgagcgacagattccagttcttcagacaaacaatggtccaagtctaacaggattgactactatagcagctcatctagtcaagcaagccaacaaagaatatttgctggggagtactgcagaagaaaaagcaatcgttcagcagtggttagaatacagggtcactcaagtagatgggcactccagtaaaaatgacatccacacactgttgaaggatcttaattcatatcttgaagataaagtctaccttacagggtataactttacattagcagatatactattgtactatggacttcatcgctttatagttgacctgacagttcaagaaaaggagaaatatcttaatgtgtctcgctggttttgtcacattcagcattatccaggcatcaggcaacatctgtctagtgttgtcttcatcaagaacagactatatactaattcccactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - estrogen receptor binding site associated, antigen, 9 - MOB1, Mps One Binder kinase activator-like 3 (yeast) - major histocompatibility complex, class II, DM beta - proteasome (prosome, macropain) subunit, beta type, 4 |