EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene View larger

EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005291
Product type: DNA & cDNA
Ncbi symbol: EEF1E1
Origin species: Human
Product name: EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene
Size: 2ug
Accessions: BC005291
Gene id: 9521
Gene description: eukaryotic translation elongation factor 1 epsilon 1
Synonyms: AIMP3; P18; eukaryotic translation elongation factor 1 epsilon-1; ARS-interacting multifunctional protein 3; aminoacyl tRNA synthetase complex-interacting multifunctional protein 3; multisynthase complex auxiliary component p18; p18 component of aminoacyl-tRNA synthetase complex; eukaryotic translation elongation factor 1 epsilon 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggccgcagagttgtcgctactggagaagtccctgggactgagtaaggggaataaatacagtgctcagggcgagcgacagattccagttcttcagacaaacaatggtccaagtctaacaggattgactactatagcagctcatctagtcaagcaagccaacaaagaatatttgctggggagtactgcagaagaaaaagcaatcgttcagcagtggttagaatacagggtcactcaagtagatgggcactccagtaaaaatgacatccacacactgttgaaggatcttaattcatatcttgaagataaagtctaccttacagggtataactttacattagcagatatactattgtactatggacttcatcgctttatagttgacctgacagttcaagaaaaggagaaatatcttaatgtgtctcgctggttttgtcacattcagcattatccaggcatcaggcaacatctgtctagtgttgtcttcatcaagaacagactatatactaattcccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - estrogen receptor binding site associated, antigen, 9
- MOB1, Mps One Binder kinase activator-like 3 (yeast)
- major histocompatibility complex, class II, DM beta
- proteasome (prosome, macropain) subunit, beta type, 4

Buy EEF1E1-eukaryotic translation elongation factor 1 epsilon 1 Gene now

Add to cart