Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DMB-major histocompatibility complex, class II, DM beta Gene
PTXBC027175
New product
Data sheet of HLA-DMB-major histocompatibility complex, class II, DM beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DMB-major histocompatibility complex, class II, DM beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027175 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DMB |
| Origin species: | Human |
| Product name: | HLA-DMB-major histocompatibility complex, class II, DM beta Gene |
| Size: | 2ug |
| Accessions: | BC027175 |
| Gene id: | 3109 |
| Gene description: | major histocompatibility complex, class II, DM beta |
| Synonyms: | MHC class II HLA-DMB; D6S221E; RING7; HLA class II histocompatibility antigen, DM beta chain; MHC class II antigen DMB; MHC class II antigen HLA-DM beta chain; class II histocompatibility antigen, M beta chain; really interesting new gene 7 protein; major histocompatibility complex, class II, DM beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcacattcctgccgctgctgctggggctcagcctgggctgcacaggagcaggtggcttcgtggcccatgtggaaagcacctgtctgttggatgatgctgggactccaaaggatttcacatactgcatctccttcaacaaggatctgctgacctgctgggatccagaggagaataagatggccccttgcgaatttggggtgctgaatagcttggcgaatgtcctctcacagcacctcaaccaaaaagacaccctgatgcagcgcttgcgcaatgggcttcagaattgtgccacacacacccagcccttctggggatcactgaccaacaggacacggccaccatctgtgcaagtagccaaaaccactccttttaacacgagggagcctgtgatgctggcctgctatgtgtggggcttctatccagcagaagtgactatcacgtggaggaagaacgggaagcttgtcatgcctcacagcagtgcgcacaagactgcccagcccaatggagactggacataccagaccctctcccatttagccttaaccccctcttacggggacacttacacctgtgtggtagagcacattggggctcctgagcccatccttcgggactggacacctgggctgtcccccatgcagaccctgaaggtttctgtgtctgcagtgactctgggcctgggcctcatcatcttctctcttggtgtgatcagctggcggagagctggccactctagttacactcctcttcctgggtccaattattcagaaggatggcacatttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 4 - proteasome (prosome, macropain) subunit, beta type, 4 - proteasome (prosome, macropain) subunit, beta type, 4 - proteasome (prosome, macropain) subunit, beta type, 4 |