HOXA1-homeobox A1 Gene View larger

HOXA1-homeobox A1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HOXA1-homeobox A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HOXA1-homeobox A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032547
Product type: DNA & cDNA
Ncbi symbol: HOXA1
Origin species: Human
Product name: HOXA1-homeobox A1 Gene
Size: 2ug
Accessions: BC032547
Gene id: 3198
Gene description: homeobox A1
Synonyms: BSAS; HOX1; HOX1F; homeobox protein Hox-A1; HOX A1 homeodomain protein; Hox 1.6-like protein; homeo box A1; homeobox 1F; homeobox protein Hox-1F; lab-like protein; homeobox A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaatgcaagaatgaactccttcctggaataccccatacttagcagtggcgactcggggacctgctcagcccgagcctacccctcggaccataggattacaactttccagtcgtgcgcggtcagcgccaacagttgcggcggcgacgaccgcttcctagtgggcaggggggtgcagatcggttcgccccaccaccaccaccaccaccaccatcaccacccccagccggctacctaccagacttccgggaacctgggggtgtcctactcccactcaagttgtggtccaagctatggctcacagaacttcagtgcgccttacagcccctacgcgttaaatcaggaagcagacgtaagtggtgggtacccccagtgcgctcccgctgtttactctggaaatctctcatctcccatggtccagcatcaccaccaccaccagggttatgctgggggcgcggtgggctcgcctcaatacattcaccactcatatggacaggagcaccagagcctggccctggctacgtataataactccttgtcccctctccacgccagccaccaagaagcctgtcgctcccccgcatcggagacatcttctccagcgcagacttttgactggatgaaagtcaaaagaaaccctcccaaaacagggaaagttggagagtacggctacctgggtcaacccaacgcggtgcgcaccaacttcactaccaagcagctcacggaactggagaaggagttccacttcaacaagtacctgacgcgcgcccgcagggtggagatcgctgcatccctgcagctcaacgagacccaagtgaagatctggttccagaaccgccgaatgaagcaaaagaaacgtgagaaggagggtctcttgcccatctctccggccaccccgccaggaaacgacgagaaggccgaggaatcctcagagaagtccagctcttcgccctgcgttccttccccggggtcttctacctcagacactctgactacctcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endothelin 3
- claudin 12
- WDR45-like
- glycogenin 1

Buy HOXA1-homeobox A1 Gene now

Add to cart