EDN3-endothelin 3 Gene View larger

EDN3-endothelin 3 Gene

PTXBC008876

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EDN3-endothelin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EDN3-endothelin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008876
Product type: DNA & cDNA
Ncbi symbol: EDN3
Origin species: Human
Product name: EDN3-endothelin 3 Gene
Size: 2ug
Accessions: BC008876
Gene id: 1908
Gene description: endothelin 3
Synonyms: ET-3; ET3; HSCR4; PPET3; WS4B; endothelin-3; preproendothelin-3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccggggctgtggctccttttcgggctcacagtgacctccgccgcaggattcgtgccttgctcccagtctggggatgctggcaggcgcggcgtgtcccaggcccccactgcagccagatctgagggggactgtgaagagactgtggctggccctggcgaggagactgtggctggccctggcgaggggactgtggccccgacagcactgcagggtccaagccctggaagccctgggcaggagcaggcggccgagggggcccctgagcaccaccgatccaggcgctgcacgtgcttcacctacaaggacaaggagtgtgtctactattgccacctggacatcatttggatcaacactcccgaacagacggtgccctatggactgtccaactacagaggaagcttccggggcaagaggtctgcggggccacttccagggaatctgcagctctcacatcggccacacttgcgctgcgcttgtgtggggagatatgacaaggcctgcctgcacttttgcacccaaactctggacgtcagcagtaattcaaggacggcagaaaaaacagacaaagaagaggaagggaaggttgaagtcaaggaccaacaaagcaagcaggctttagacctccaccatccaaagctcatgcccggcagtggactcgccctcgctccatctacctgcccccgctgcctctttcaggaaggagccccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin 12
- WDR45-like
- glycogenin 1
- KIAA0174

Buy EDN3-endothelin 3 Gene now

Add to cart