Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GAL-galanin prepropeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GAL-galanin prepropeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030241 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GAL |
| Origin species: | Human |
| Product name: | GAL-galanin prepropeptide Gene |
| Size: | 2ug |
| Accessions: | BC030241 |
| Gene id: | 51083 |
| Gene description: | galanin prepropeptide |
| Synonyms: | GAL-GMAP; ETL8; GALN; GLNN; GMAP; galanin peptides; galanin prepropeptide; galanin-message-associated peptide; galanin-related peptide; galanin/GMAP prepropeptide; galanin and GMAP prepropeptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgaggcagcgccctccttctcgcctccctcctcctcgccgcggccctttctgcctctgcggggctctggtcgccggccaaggaaaaacgaggctggaccctgaacagcgcgggctacctgctgggcccacatgccgttggcaaccacaggtcattcagcgacaagaatggcctcaccagcaagcgggagctgcggcccgaagatgacatgaaaccaggaagctttgacaggtccatacctgaaaacaatatcatgcgcacaatcattgagtttctgtctttcttgcatctcaaagaggccggtgccctcgaccgcctcctggatctccccgccgcagcctcctcagaagacatcgagcggtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WD repeat domain 22 - carbonyl reductase 4 - ribosomal protein L8 - annexin A8-like 2 |