GAL-galanin prepropeptide Gene View larger

GAL-galanin prepropeptide Gene

PTXBC030241

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAL-galanin prepropeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GAL-galanin prepropeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030241
Product type: DNA & cDNA
Ncbi symbol: GAL
Origin species: Human
Product name: GAL-galanin prepropeptide Gene
Size: 2ug
Accessions: BC030241
Gene id: 51083
Gene description: galanin prepropeptide
Synonyms: GAL-GMAP; ETL8; GALN; GLNN; GMAP; galanin peptides; galanin prepropeptide; galanin-message-associated peptide; galanin-related peptide; galanin/GMAP prepropeptide; galanin and GMAP prepropeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgaggcagcgccctccttctcgcctccctcctcctcgccgcggccctttctgcctctgcggggctctggtcgccggccaaggaaaaacgaggctggaccctgaacagcgcgggctacctgctgggcccacatgccgttggcaaccacaggtcattcagcgacaagaatggcctcaccagcaagcgggagctgcggcccgaagatgacatgaaaccaggaagctttgacaggtccatacctgaaaacaatatcatgcgcacaatcattgagtttctgtctttcttgcatctcaaagaggccggtgccctcgaccgcctcctggatctccccgccgcagcctcctcagaagacatcgagcggtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 22
- carbonyl reductase 4
- ribosomal protein L8
- annexin A8-like 2

Buy GAL-galanin prepropeptide Gene now

Add to cart