WDR22-WD repeat domain 22 Gene View larger

WDR22-WD repeat domain 22 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR22-WD repeat domain 22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WDR22-WD repeat domain 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022967
Product type: DNA & cDNA
Ncbi symbol: WDR22
Origin species: Human
Product name: WDR22-WD repeat domain 22 Gene
Size: 2ug
Accessions: BC022967
Gene id: 8816
Gene description: WD repeat domain 22
Synonyms: WDR22; BCRG2; BCRP2; D14S1461E; DDB1- and CUL4-associated factor 5; WD repeat-containing protein 22; breakpoint cluster region protein, uterine leiomyoma, 2; DDB1 and CUL4 associated factor 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaggagagctggcctggggggcagcatgaggtcagtggtgggcttcttgtcccagcggggcttgcatggggaccccctgctcactcaggactttcagaggagacgcctgcggggctgcagaaacctctacaagaaggacctcctcggccacttcggctgtgtcaatgccattgaattctccaacaatggaggccagtggctggtctcaggaggagatgaccgccgggttctgctatggcacatggaacaagccatccactccagggtcaagcccatacagctgaaaggagagcaccattccaacattttttgcctggctttcaacagtgggaacactaaagtgttctctggaggcaatgatgagcaagttatcctccatgatgttgaaagcagtgagacattggacgtgtttgctcatgaagatgcagtatatggcttgtctgtgagcccagtgaatgacaacatttttgccagttcctcagatgatggccgggttctcatttgggacattcgggaatccccccatggagagcccttctgcctggcaaactatccatcagcctttcatagtgtcatgtttaaccctgtggagcccaggttgttggccacagccaattcaaaggaaggagtgggactctgggacattcgaaaacctcagagttctctcctgcgctatggtggaaacctgtccctccaaagtgccatgagtgtacgattcaacagcaacgggacccagctcctggccctgaggcgacgcctgccccctgtgctctatgacatccattcccgcctgcctgtgtttcagtttgacaatcagggttacttcaactcatgcaccatgaaaagctgctgttttgcaggagatcgtgaccagcatcacaactggaaatggagagcccaagctgtgagtttccagccttttctgagtctcaccaggaatggagatgctgatgttgacttaaagctggcagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonyl reductase 4
- ribosomal protein L8
- annexin A8-like 2
- ribosomal protein S2

Buy WDR22-WD repeat domain 22 Gene now

Add to cart