PTXBC022967
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022967 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WDR22 |
| Origin species: | Human |
| Product name: | WDR22-WD repeat domain 22 Gene |
| Size: | 2ug |
| Accessions: | BC022967 |
| Gene id: | 8816 |
| Gene description: | WD repeat domain 22 |
| Synonyms: | WDR22; BCRG2; BCRP2; D14S1461E; DDB1- and CUL4-associated factor 5; WD repeat-containing protein 22; breakpoint cluster region protein, uterine leiomyoma, 2; DDB1 and CUL4 associated factor 5 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaggagagctggcctggggggcagcatgaggtcagtggtgggcttcttgtcccagcggggcttgcatggggaccccctgctcactcaggactttcagaggagacgcctgcggggctgcagaaacctctacaagaaggacctcctcggccacttcggctgtgtcaatgccattgaattctccaacaatggaggccagtggctggtctcaggaggagatgaccgccgggttctgctatggcacatggaacaagccatccactccagggtcaagcccatacagctgaaaggagagcaccattccaacattttttgcctggctttcaacagtgggaacactaaagtgttctctggaggcaatgatgagcaagttatcctccatgatgttgaaagcagtgagacattggacgtgtttgctcatgaagatgcagtatatggcttgtctgtgagcccagtgaatgacaacatttttgccagttcctcagatgatggccgggttctcatttgggacattcgggaatccccccatggagagcccttctgcctggcaaactatccatcagcctttcatagtgtcatgtttaaccctgtggagcccaggttgttggccacagccaattcaaaggaaggagtgggactctgggacattcgaaaacctcagagttctctcctgcgctatggtggaaacctgtccctccaaagtgccatgagtgtacgattcaacagcaacgggacccagctcctggccctgaggcgacgcctgccccctgtgctctatgacatccattcccgcctgcctgtgtttcagtttgacaatcagggttacttcaactcatgcaccatgaaaagctgctgttttgcaggagatcgtgaccagcatcacaactggaaatggagagcccaagctgtgagtttccagccttttctgagtctcaccaggaatggagatgctgatgttgacttaaagctggcagtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - carbonyl reductase 4 - ribosomal protein L8 - annexin A8-like 2 - ribosomal protein S2 |