Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LRRFIP1-leucine rich repeat (in FLII) interacting protein 1 Gene
PTXBC010662
New product
Data sheet of LRRFIP1-leucine rich repeat (in FLII) interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRRFIP1-leucine rich repeat (in FLII) interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010662 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRRFIP1 |
| Origin species: | Human |
| Product name: | LRRFIP1-leucine rich repeat (in FLII) interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC010662 |
| Gene id: | 9208 |
| Gene description: | leucine rich repeat (in FLII) interacting protein 1 |
| Synonyms: | FLAP-1; FLAP1; FLIIAP1; GCF-2; GCF2; HUFI-1; TRIP; leucine-rich repeat flightless-interacting protein 1; GC-binding factor 2; LRR FLII-interacting protein 1; NEDD8-conjugating enzyme; TAR RNA-interacting protein; leucine rich repeat (in FLII) interacting protein 1; LRR binding FLII interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatgtaatggacctacaaagggatgccaacagacagatcagcgacctcaaatttaaacttgcaaaatctgagcaagagataactgcattagaacaaaatgtaataaggttagagagtcaagtatcacgttacaaatcagcggctgaaaatgcagaaaaaatagaagatgaacttaaggcagaaaaacggaaactccaaagagagctccgctctgcattggataaaacagaagagctcgaggtgagcaacggccacttagtgaagcgtctggaaaaaatgaaagcaaatcggagtgcactcttgtcccagcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras association (RalGDS/AF-6) domain family member 4 - eukaryotic translation elongation factor 1 epsilon 1 - estrogen receptor binding site associated, antigen, 9 - MOB1, Mps One Binder kinase activator-like 3 (yeast) |