Login to display prices
Login to display prices
MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene View larger

MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene

PTXBC010464

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene

Proteogenix catalog: PTXBC010464
Ncbi symbol: MAP3K3
Product name: MAP3K3-mitogen-activated protein kinase kinase kinase 3 Gene
Size: 2ug
Accessions: BC010464
Gene id: 4215
Gene description: mitogen-activated protein kinase kinase kinase 3
Synonyms: MAPKKK3; mitogen-activated protein kinase kinase kinase 3; MAP/ERK kinase kinase 3; MAPK/ERK kinase kinase 3; MEK kinase 3; MEKK 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgaagcaaatgtcatgctgccttattcagggaaggaggagcctgtcctgcctgtggccatgaccctgcctctcccaggcaggggcccgcgatgtggaactgctgccactgaggggggatccagttttgtcaatgcagttgtctctgttttacaagttggagtcactcttatgctgtacccagtttctaaactggagactgtgtgtgccctctgggctctgagtacccctgctttgggcttgggcctaggctgcattgaaaagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: