UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene View larger

UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene

PTXBC015316

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015316
Product type: DNA & cDNA
Ncbi symbol: UBE2Q1
Origin species: Human
Product name: UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene
Size: 2ug
Accessions: BC015316
Gene id: 55585
Gene description: ubiquitin-conjugating enzyme E2Q family member 1
Synonyms: GTAP; NICE-5; PRO3094; UBE2Q; ubiquitin-conjugating enzyme E2 Q1; E2 ubiquitin-conjugating enzyme Q1; galactosyl transferase-associated protein; protein NICE-5; ubiquitin carrier protein Q1; ubiquitin conjugating enzyme E2Q family member 1; ubiquitin-conjugating enzyme E2Q (putative) 1; ubiquitin-protein ligase Q1; ubiquitin conjugating enzyme E2 Q1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacttctcaccaaacagggctggagcagtgcctactccatagagtcagtgatcatgcagatcagtgccacactggtgaaggggaaagcacgagtgcagtttggagccaacaaatctcaatacagtctgacaagagcacagcagtcctacaagtccttggtgcagatccacgaaaaaaacggctggtacacacccccaaaagaagacggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitogen-activated protein kinase kinase kinase 3
- C1q and tumor necrosis factor related protein 4
- ubiquinol-cytochrome c reductase complex chaperone
- family with sequence similarity 108, member A1

Buy UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene now

Add to cart