Cart 6 Product Products 1 871,24 € (empty)
No products
To be determined Shipping
1 871,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 871,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 871,24 €
View larger 
UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene
PTXBC015316
New product
Data sheet of UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015316 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2Q1 |
| Origin species: | Human |
| Product name: | UBE2Q1-ubiquitin-conjugating enzyme E2Q family member 1 Gene |
| Size: | 2ug |
| Accessions: | BC015316 |
| Gene id: | 55585 |
| Gene description: | ubiquitin-conjugating enzyme E2Q family member 1 |
| Synonyms: | GTAP; NICE-5; PRO3094; UBE2Q; ubiquitin-conjugating enzyme E2 Q1; E2 ubiquitin-conjugating enzyme Q1; galactosyl transferase-associated protein; protein NICE-5; ubiquitin carrier protein Q1; ubiquitin conjugating enzyme E2Q family member 1; ubiquitin-conjugating enzyme E2Q (putative) 1; ubiquitin-protein ligase Q1; ubiquitin conjugating enzyme E2 Q1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacttctcaccaaacagggctggagcagtgcctactccatagagtcagtgatcatgcagatcagtgccacactggtgaaggggaaagcacgagtgcagtttggagccaacaaatctcaatacagtctgacaagagcacagcagtcctacaagtccttggtgcagatccacgaaaaaaacggctggtacacacccccaaaagaagacggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitogen-activated protein kinase kinase kinase 3 - C1q and tumor necrosis factor related protein 4 - ubiquinol-cytochrome c reductase complex chaperone - family with sequence similarity 108, member A1 |